Description :
From Genome Similarity Track
Location :
Scaffold_103:44847- 49954
Sequence
5107 bases(100 bases per row)
TGTTTTGTTGAGCTAGATGACTCCATAAGGGCTCGTCACATCGTCGATGAGCAAATGCGACCTGCATTTGCTCAGTCGAACTTGGCACGAAGTGCGAAGA
CTTGGTCCTTGGGCCTCAAGCTACATGACCCATACGTCTTTGGGTCGTTAGAAGTCTTCAAGTCACGGCTTAGACAAAAAAATTGAACCTCCTCGGGCTG
AGTTCATGGCTCACTCAGAACTCCTGAAACTCGAACAAGGAAAACGTGATGTACATTCATTTATTTAGTACATACGTCACCTTACGGTGCATTACAGCAA
ATCTGCTATATGAACAACGTTAATCACGTTGTTCATATAATGTCTCATGGACGGTCCAGTCAAGATCTACCTGTTTCGACTGGAATTTAATACCCTGGAA
GAGGCGATCCGGGTTGCGGAACAGGAGAATTTCAGCGTGAAACAAGATCACGTGAATTTGAGCTCCTATCGTTCCCTGAGACGACAGGAAAGTGGGTCCC
ATAACCAATGGACCTCTGCTACGCTGAGAGTAAAATCTCTAGCGTTACCATTATAAGAAATTGCAGAAATTCAATAGATGTCAAAAGACAGGGTATTATG
CATACAAATGCAGTGCCCCGAACGCGGGACCACGTACCGCAGGAAAAAAGTGATCGTCAAGCGGCCAATAATGGTCGAAGGCGTGGGTCAGACACTGTTG
AAAACGCAACAACGTAATAGACAGCTAAAAAGCGGTCGGGATCAGTAGGTGCGGAGCACCCTACTGATCCAGCAACGTCAAGTAAAATTACAGTTATCTT
GACGAGAGTTGATCGCAACACGCAATCATTGTGTGTTACTGAATCTGGTAACAAGATTTCCCTCATTCCCTTAAAGCTTGGAGTGTCAAAGGACATGTCA
CTACAAGCCTTAGTCGATTGTGGGGCGTCAAACTACGTCGTACGACGCCAGTCTCTAGACGAGAGCAAGTTTAATTTCATTGAGCACGAGATCCCTCCAC
CGAGGATAACTGTACGCCTCACTACAGGCGCACCCGGAACAGTGAAGGAACGTGTAGTGGGGATTACCTATACACTGGTAGAGGTCCAACACAATGATGA
CCTCATCGTACTGGACTTGGATGGCGGGTTTGATTTAATCCTTGGTCTACCGTGGCTCAGAAGGTATGAGCCACAAGTCAGCTGGCATCGACGAACAGTC
GATATGTCTACCACTTGTTCACCAGATGGCCATATGATACGTCTTGGAGAGCCCACAAACATGTGGATGTACTACGAGTGAGTGCGCCGGCCTCACGTGT
GATTTGGTCGCTAGAACGACCGCACAAGATCGCACTGTGACTAACCATCACACTGTGGAGAAAGTTGCCGGTGACTGCATAGAAATGCAGGAAACTCCGA
AGGCCCACTACTCGAATAAGTCGAGCAGACCGGGGCACGGATACCCTCTTGATGGACAACACCCAGAGAATCACTAAATGATTGCCAATAATTGGCAATA
CGACGATCCTATATCGATTGAAGAATTGAACGTAAATGGCACGTCCGCGGTAGCTCAACCACTTCCAGAAGACGCCGAGGGAGCAAGTCCCCACGTATCT
GAAGATGAGATATCCAAAAATGCTAGAGCTGAGGGAATAATTCCCCAACAGACAGTGGAAATAACTTAGATATTCCACAGTCTGTTGGGGAATTATTTCC
TCACCAAATTAGAAAAGTAAGCTAGGGCAGTGTAAAACAATAAAAAGTAAGCTTAGCACTGCCCTATTTATACAATTTCAAATATATATATTGAAGGCGT
GATATAACAGAGACATTGAATGTCCTGGTTAATAAAGGGTCAAGCATAGGTGGTTGTACACTTGATCTGATCGTGCCTCCGAAGTTAACGTTGGAGATCA
CTCAGTTACCCACGGTGGAAAAAAAGAAGTTCGAGCGTGACCTACGTGGTGGCAAAGTCAAGAAGATCTGCGCACTCATCGCGAAAGACGAGTACTTCAG
CAATATCCGATCGGCAATGGTCTTTGCCGAGGGTGATAGATTACTTAGTAGATCATCAATGAACTAAAGGTGTCCTTGATGAGAAGACCCGGATTGAGTG
ATACACATTCCAATAGTGAGAGTCGATCTAGGCAAATCCTCTCTACGATGATTTGGTAGAATTTAGGGATGTGTTCCCAGAAGCAGTGTCACGCGAATTA
CCTAAGGACAAAGGTACTCGTCACGAATTCGGCCTGAAACCGGGTTCGAAGTACTGTGTCACGAAGCAGTGGCCACTGACTCGTAAACAAGTACTAGCGA
TCGAGAATTACTTTTCAGATCGCTTAGCAGCCGGCCACGTGAGGTAGTCGAACTCCTACATATCTCTTCGAACTTCTGTTTGCAAAAGGCCACAGGAGAA
TGGCTGATATTGCACGCATTCAACAAGTTGAAAACGCTGCAACGATACCGTCTCAAACGCCGATACCGAGGAAATGTGTTATCATAGATGGTATGGCAAC
TAGTACTATCTTTTCATCAATGGATCTGATGTATGGCTTCTATCAGATCCTTATGCGTGACAGGGACATCCATATACCGTAATGAGCACCCCAAGCGGTA
GTGGTTGGTAATGGCACAAGACTAAGCAATACCCCTGCTACATTTATGAGATAAGTGACAAATCTGTTAAGATCTGTTCGAGACTTCGCCCGCAATTACT
TTATTATGTGATCGTCCATAGCCGATCTATGGAAGGACAGGCGGATGTGGAACTGCACTAACTCCACGTCCGGAAGGTTCTTACACTCATGCGTAAGCAC
AAGCTGTATGCCCACCTCAAGATGTGCTTAGTTGCTGCTAGCGAAATACCACTTTTCGGGTGTATTGTGGGTAAACATGGCGTACGCCTCGACCCGGAAA
AGATCAAGGCGATCACCAACTGGCTGGTGCCTATCGATGTAAAAGGACTTCTGAAGTTCCTTGGATTAGCGGCGTATTTGCACAAGTAGTCACATAATTA
CGCCGAGATGACTTTTCATCTCTCTCGTTTATTTAAAAAGAAAGAGAATTGGGTATGGAGTGCTAACTGTCAGCGCTCCTTCGAAGGTATTAAGAAAAGC
TTGATACGGTCGCCTGTTTTTGGCAATTGCAGACCAAGCCAGGCCATTTCATGTGGCCTGTGATACCAGCGATTTTGTAATCGGCTACGCATTAATGTAG
TACGATGCAGAAGTTGAGGACGAGTCGTCTGCTGTCAGTCGCGTCAGCTGCATCCAGCTGAACGTAACTACCCCGTCCATGACAAGGAACTTCTTGACAT
GAAGTACGCGTTGGCGAAGTTCAGGGTCTACCTGCTAGGCGATAGACCCTTATCATTTATACGGACCATGCGATTTCAAGAACGGCCGTAAAAGTCCACA
CCTTTCACAACTAATGGCAAGGTGGTTGTCATTCTTCGTGGAGTATTGCCTCTCCATATCGTATAATCCAGGACGACTTAACGTCGTCGCTGACTTACTC
TCGTGCCGGCCCAATTTTGAACCGGCTGCGCAACCCGACACTGCTGTAACCACTGTTGCGGTATTGACCTCAAGTGTCCCGTCGTCCACCTTACTAGAAG
ACATACGGAAGGCGTATGATCCGGAGATTGTGAGTCTGATGAATCATCTCTCGCAACCTCCCCGGAAGAGCCTAAATCAGCTGTCGGCAGTATATCTAAC
TTCACCAGATATATATATATATATACAGATTGCAACGGCTTACTGAAATATTCAGCTGTTACCGGTGACACGCCTCTTTTCGTCGTACCCAATCACGGCG
ATATGCGCTTGCGGGTCATGTGTGAATACCATTACGCTCCTATTGGTGGACATTGTGGTCGCAAGAAAATATATATCACGGTGAGCCGAGACTTCTACTG
GCCTCGCCAGTATCAGTTCGTACGCAAGTACGTCCGTGCATGCGAGGCTTGTCAACGGGTTAAGTCTATCCCTTCCCTTCGTGCCCCGTTGCAGCCTCTG
CCTGTCACGACCTAGTGTTGGGAATCCGTCTCAATGGAACTCGTCTTCGGTTTTCCCGCCGATACGCACAAGAATACTGATATTCTTGTGTTCGTTGACA
AATTCAGCAAGATGGTACACCTGTTCGATGTAACCCAATCAATTAACATATCGAGTTTTTCTCGTGTCTTTATTGACACGGTCTTTTGCCTTTATGGGAT
TCCTCGTGAACTCGTCCGATTCGGACCCGCGGTTCACAGCTGAGTTCTAGCGCTCCGTGTTCAAAACACTCGGAACGCGCTTAAATATGTCCACATCTGA
CCACCCTGAAGCGGATGGTCATGGGGAACACGCCAACCGTGACCTCGAAGAGATACTTCGAGGGTACGTCCATTCTTTTACAAATTGGAGATAATTCTTG
CCAATGGTAAAATGTGCCATTAGCAACTCGGTACACGCGTCGACAACGCATACGCTATTTTTTCGGGGATGGCTTGCGCCATCCGCGTCTTCCCACCTTA
TTAAGGTGTGACTCTAGTTAAAGGGGGAGGTATTCCTTCGAGTGAACGCCAATACGGCCCTCACTCATCTAGTACTGATTGTGAGATCACTGCGTACGAA
GCTGATGTCAATCGCATCGACTTCGGTGAAGAAGAAGAAAGGAAGAACGATGCTGAGAAACGCAGCATCTCGTCCAGTGATTTCCAAGACGCTCTCGCTG
AAGCGAAATCTGATCTTGCCACCGTACACTCTAATAGCACTGTAGCCAAAGACAGCGAGTCAGCAGATAAAATTCATACTGTATCGCAAAACGTTGTCCA
TTTCTTACAAGACTCCATCGCAGAAGAGATGAATCGACAAAAGCGAAACACTGGCAAGAATGAAAGGGCAAACGTTCTTTTATTTAATGAAGGTGACTTA
GTCGTACTATTTACGGTAAACTTACCATGACACATACTGACAAACGTGGGTAGTAACGAGCTGCTACCCAAGTTCATCGGTCCATTTCGTATGCTGAGCC
GCCTAGGTAACGCATATACGATTGAAGAGCCACTTGAGATACGCGCATCCTACGTTCTGCGTCGGTCGCCTTATGCGATACTACCTGTACGGGGCTTCTT
CCGGTAA