Description :
From Genome Similarity Track
Location :
Scaffold_184:44845- 46187
Sequence
1342 bases(100 bases per row)
CAACTCATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCTGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGC
CACCTCGCCATCCTTTGGGAGAGGTGAGGCAAGTTAGTCGCCGTCCTCGAGGACGCGTGGTCTGTGTAGATTACAAAGGGCCTAGAGCCCAGAAGGTGAG
CACGAAACTTCACAAGGGCATACTTCATTGGCAAGAGCTCCTTGTCGTGAACAGGGTAGTTCCGTTCGGCAGCTTTGCGCTGTCTGGACTGGAACGAGAT
GACGCGTTCGCGTCCAGCCGTGTCAGGCTGCAGCAATGCACAACCGATGACATAGTCGGAGACATCGCAGGCGACGCTGAGCGGCCTCGTCTCGTTCAGC
AGGCCAGGACAGGAGCCTCTTGGAGACTGGCCTTGATGCTGCCAAATGCATCCTGGTGCTGTTGGTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCT
CGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGTTAGTTGGCCAAGCCCAACCACTTTCGAAGATCTTTCTGGGATCGGGGCGTC
GGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAATCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGC
ACTTGTCGATGTTGGCTTAGAGCTTGTTCGCTCACATTACGTCTAATACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGC
ACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAATGTCGCCGGGGCGTTA
GACAAGCCCTGCGGCATAACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGTTCTTGCGCATCAGGATTTGGTAGT
ATTCGTCTACCAAATCCAGCGCACTGTACAGTACGCTTTCGGCCATGTTGTTCAACAACACATTCTTTCGTGGGATTGGTGTCTGGACCGGCGCCGTCGC
GTTGTTCAGCTTGTTATAAGCATAAACTAGACGCCACTTCCCGCTCGGCTTCCGAACGCAGAATGTTGGCGTCGAGTGCGGATCCTTTAACTACCGCACA
ATGCCTGCTTTTGCTTTCGCAGCAAAGAAGGCATCGATGACCTCGCACTGTTCGCGAGGAAGAGGCCATTGTCTCGTGACACAATACTTTGTGCCAGACA
CGAGATCGATCTCATGCCGTACGCCTCCATCCGGTGGGAGTT