Description :
From Genome Similarity Track
Location :
Scaffold_194:4484- 12111
Transcript NameFunction/comments
Hyaar_Emoy2812328reverse transcriptase
Hyaar_Emoy2812329PREDICTED: uncharacterized protein LOC101496047
Hyaar_Emoy2812330hypothetical protein

Sequence
7627 bases(100 bases per row)
CACACCTCCTTGTATACGTCAACCGCTTGTCGCTTCGATTATTCGTTAACCTTCAGCTTCCTCTCCGTAAGATTGCATCACCTCGAACCAGTTTTGACTT
ACACGATTGCGCTTGAAATCCTGCAGCAACGCGCCACAGTTCAGATCTGCTTCGTCGATCCAGGTCGGATCGCTATGTAGCTTCCACTACACCAAATATT
GTCTATGTACTCGGCCATAACGGGTCTTACGTCCCGATCGCACGTCCAAAATTTGCTCCACTTCGTATTCATCAGTAGCCAGCTCGTTCTCCCAACTGTC
TTCCGGAAGCAGCGACTCATCGAAAATCACGCGATCCCTACAGTTGACCACTAACGTATCGCCTGGGCGATCGCGGATCTGTACCACTTGTTTTAACTAG
GAAACGTGCACTACTGGAAACAGTTGGTTTGGAGTTCCTGCGATCTCCAAACGGACTGCATGCTCTTCACACAATTCAGTCACTCGAAATGGTCCATGGC
ACACATGTGCTAATTTGCGATCATAGCCGTCTTTGACCCGATCTAAACAAAGCCAAACTTGCATCCCACACTCTATGTTACACGATCCCTAATTGACATT
ATGCTGATACGCTCGATCTCGGATTGCGATCTTGAGACGTTCGTTTACCGTCGCTCTTGCTTTTTGATATTGACGCTGGATGTTATATCTCCATCTTTGA
GGGTCAACATCGCGCGTGTTTTAGTGCTCGCTAGCAGTAGGGTTGCTTTCAACGTCGGTTGTCGATCCCAGCCATGGATCAAATAGAACGAGGTGTCTCC
ACGGACATGATATTACGCCGTGTTCATGGCGAATGTCAGTCCTTCCGCATATTCATCCCAATCCTTCAGATCCACGTCCGTGACGTACATCTTGATCTCT
CGAGTCAACGTCTGCATCATGCGTTCCGCAATCCTGTTCGCTTGTGGTTGATAGGCCATGGTTGCGCACTGCTTTTGCCCTGCGATCCAGTTAAACGCTC
TATAAAAATCTGACATAAATCCAGGCTCCCGGTCGTGACGTATAGCTTTACTTGCTTTAAATCTTCGAAATACCCATTCATCATAGCCTTCAGCGATCGC
TTGTGCGGTCTTCGAAGAACTTGCACTCGCAATCAAGTAACCCGAGAAGGGATCTACGCACACAAGTAGTTCGGTGTTTCCTTTAAATGACCGTGTCAGA
GATGGGATGTAATCCATTGCGATTACCTGAAATAGGTATGTAGCCTGTATATTCCCAGGGGATCTGCCACTGATCGCGAGTAACCCATTACAGTCGAGCA
GTCCATACGTTCGCTAAAATAACGCTGGATACCCCGATATAGACCTCTCCAAAGGAAATTATACCTGATCGCTGATGTGTCTTCCCGATCCCTTGGTCAT
CACCTTCCAAACTCGTATGGTATGGTGCATACAGTCCTGTTGTAACAATTCTAATAAATATTAGACGGACCATCTCCATGCGATTGTCCGACTGTTCAGA
GGATCAGGGGCAGAAAAAAGAGCAATCCACTTCGTCGTCTGGAGCGATCCGAGCGCATAATTTTACATTTTCGGCGTTCAACTGGGTTAAGTCGCCTATA
GGATATTCCTTCAGGTTGGCGATCCAGATTTCTTCTTCTTGTGCCTGCTTTTACGCTCGATCCGCATCTGCTGCACTATTTCTTCTGGCAGAATTTCGGG
TCGTCGAAGCCTTCGCTGCGCGGATCGTGTGATCGCTGCCATCTTCCCTACGCGGTCCATCATTTTTGGCATAAACAATTCGCCCAGCCGGTTAAGTGAT
GTCAAATCTTGTAAAACTTGATCCGATGTTACGATGGTACCCTTCTCCTGCTGCAAGGATGCACTCTCTAGTCGATCTGCGCTCTGGTTCCACTCTCGCT
TTATATGTAAGAACTCGTACTTCGGACATGATCGAAGTTTCTGTATCGCTTTGTGAAGCAGCAGCAGCTTTATATCGGGCCCTTTACAGTCCACTTTATC
CCGCATCTGCCGGATCACTGGGTTTGAGTCACCACATATAACGACGCTCCCTAGTTTGGCCATCCAGCAAATCGAAACTCAGTAACAGACCACGATGTTC
ACCCGCATTCACCGTTAAATCCGCTTCACATTCCGAAGCAGCCGCTATAATCGTCCATTCTGGTAGTTTCCATACGATCGCGATATACGACCCACTCTTC
CGTTTCGTTTGGGCCGATCCGTCGAAGCTAACCACCAGTAGTCTCTTATCTGTTTATACTGTGGGGGGGGGGCTGTGTGGCATGATTACAATATGTCTAG
GTTGCTTTTTTGGATCGATAGCGATCAACATCTCATCTACATCTTCTCAAGGAGTTATGCTAGCCGCGAGTGTGCCGAGTAATTCATCTTCCCCATTTCA
CATCTCCTAACCTCTAGTGTCCAGTTCGATAGCAGCGCGGCCCATCTTCCTAGTCTCCCGTTGAGGCCGGGGGATTGAACTAGCCAGTTTAATGTCGAAT
ATCGAGTGAGCACCTTGATCTCCCGGGATACTAGCATAGTATAGCACATGTTCAAAATTCGAAGCAAGGCTAGCACCTCTTTCTCCACCATTCCATAATT
AATCTTATTGGGCTTCAGTGTACGGCTCGTGAATGTCACCGGCCAGTATACGCCATCATATTCATGTAGCAGGGATGCCGACACTACCCAATTGCTAGCA
TATATCACGATCACTGGAAGTCGATATCAGTCGTAGTGCTTGGGAATCGAGGTAGTAGCAATCTTGGCCTTCAACAGAGCGAATGCGATAGTGAACTTTT
CCCACCGAGATCGTTCATTCAGATCAAGATCACCTCCTTATAGGGTGCGATCGCGAACTCTTGCCATCGCATCACGATCATTCATATGATTTATCTCTAA
ATAGTCTGCATCTCGTAGATCGCACAACACAGATGTGTGTACTGCAAAATCTATAATAAAGCGACTGTAGTAGTTTAGACTACCCAGGAACGATTGCATG
GAGCGCAACGTTGTGGGGAAGGGGATGTTAACCAGCGATTATAGATCTTTAGGATTAGCTTCCGACCCGGTTAATCATACCTGGTGACACAGGTAATCCA
CCTTACGCCGCCAAAAAAAACTCTTGGTCAAGTTGATCGACAAATTCCATCGATCGCATACCGTCAGTAGTCGCTCTAACTTGTTATAAAGGGAAGTCCA
CGACGTAGATAAGATCAATATATCATCAGTATAAGATCGTCTACCCAGCACTGACGGCGTCTGGTCGGTTTATGGTTCTCCTTCAGTGAACACATTGGTC
AACCTAGAGGAATCTGTTCCGGTCGCATCCTTGCCCGCGCCGATCTTGAGATATACATAGAAATCGTTATCAATCAAACGCTGGTAAATCTGTGGAGCGT
TCTTCAGTCCAAAAGGCATCCTTAACCATTCAAACAGACCCGACGGTGTGGAAACGCAGAGATTAACTTTGCTCGTTCGGTCATCTCCACCACCCAAAAT
CCACTAGCCATGTCCAATATACAATACCACATTGCCTTGTTTATATCTTGAAACAATATGCTGATAAGCGTAATGGATAAATCATCAATGTGTTAGCTGA
TTCACTCGTCGATAGTCTATACATAGTCGGATGTATTCTCCATTATTTTTAATAATCACGACCATTGGTGACGCCCACGGCGATGTCGAAGGTCGAATAA
TCTTAGCTGACAACAGTCCTTTTATCAGATCAGTCAACTTCTCACGAGATTTAGGCGCAATCAGTCGCCCGCGCTGCGCGATCGACCTTGCTTCTCCAAC
ATCAATATCACACACGGCCCCACGTGCTGCATGGGGTAACCCGTTTCCTTTCCCAATCAACAGGTGACGACTCTTCCATATCACTTGTCGAAAATCCTCT
TGATCTTTTGATAAGGGTACCCCAGCATCGCCGACCTGGACAACGTCGATCGTTATCTCTGTCCCAGATGTCGTTACCTCTGGTAGCACAGCCATATGCT
GCTCCAAATCTTTCTCGAACAGTTCGCCTCCTTCGTGGTAACATATTGATGCAGCCGGTACATCTTCTTTCATCATTCCTCGTCGATCGCAGCAGCCTCT
GCTCTGTCGACCAATCGTGTGGACCGGCCATGGACTTCCCGATCTTCGACCATGATCTCATCTTGCTGATAGTTGGACTGTACTTGTAGCGGATCAGTTG
TCAAATGGTCGACCTCCTGTGCTATATCTCTCTTTGTCTACCCCGTCTACTTCGCTCGATCGTTCTAGGGTCTTCCGCACTGCGTTGGCCGCACACGATC
CCTTTGTCGATATAACGTCCTTGACTTCGTTGATCTCCCCAACCGTATACTCGTCTTGAATCTCACCGTCAGTGTTACAATCAGGTTCGGATCGCGTTGC
GATCCCAGTAGAAACCTTTATGGTTTCTGATTCCTTATCTGGTCGAGTAGAAATTCGGGTGGGTTTCTCGTACGTAGGGCGATCTACTAGTGGTCCCGCA
TATGCTTCAAGCTCTTCTTCTTCTCGAACTGTAGTAGCTTCAAAGGCCAGTGTTTGCCATTCCTTATACCGCCGCGATCCGTCAGAAACATATCCCTGCA
ATCGCGGTATCATGTCCGCTGTCATCCAAAATGCTAGTGGAGCTCCGTAATTTACGTTCAAGTCGCGATCGCCTATATTCGTAAGCTCGAGAAACTTGAT
CTGTCCGGGCTTATTCGTCACTGTTCGTACCGACGCCACATCTCGCCTCACCCAAATTTTGGACTTGGGGGATTGACACCGATCCTGGCTTCGGTTGATC
TACCGGCAGGGATGACAATATGTTGATCGTTAAGGTTGATCGCCGGTATATTTGATCGGTATGGCGGTCTCCGCCCAGCAAAAACGCGAACTTCGTCCGG
TGGACACAGGGTTCCGTTGGCTAAATCGAAATGAATGCCTGCTGCAACCATGAAGTCCATACCTAGTATGGCTTCTTGACCAACTTGATCCCCAACCCAG
ACATCAAGATAGTATACTAGCGATCCGCCCAATGTGATTTTGACCTTGGTCCGCCCCACTGTCATATAAGCACTCTCCCCGATCCCAAGACATTCTTGCG
TTCGGCTCTCGTCAATCACACATCCTACTTTACGAGCAAAGGTTGTGTCGATGATCAAGATTTCCGCACCAGAGTCAAACAGCAGAGTGGCTTTTCGCAT
TGTTAAACTTGCCCACTGCTTTCGCTTGTTTGAACCATTTTTCTGAGGTACGATACTTCCAGTATCCCTTTGACTCCCCTCGGGAGAGATCGAGCTTCAT
CTTCACCGGTATTCGGGCATAATCGTCCACTCTTTTCACACTTGATATTGAGGAAACAAATGTAGAACGATCACATATATTATTGATCGGATCGCGTCTA
TCTTTAACTCCTTGATCCTCCAGTATTTTCAACAAATGCATATATGCATAGCCTAGAACGCTCGGATTGTGCCAGATTCCAACCTGGCGAGCCTTCTAGT
ATAACATCTCCTCGATCTTTGGAGGAAACATCCCAGCATGTTTGGTAGGCACGTACCACTTGCGGATCAAGTTGTAGAATTCTTCAATGGGGCACTTGCC
ATTCCCATGCATCTCCCCACAAGCTTCACACACATAGAAACACTTGTCCGACGGGTGTCCCTTGCGACCGCACTTCTGGCACGTCAGTCTCTGCCATCAT
CCACGATCGTTGTGTCTCTTCGATCCGCAATGAGTGCAGGCTTTCTGAAACGCGACGCGGTACGGACTATATTCTTGACGATTCTCGTCGGTTGTAGCAC
GTTGATCTCCTAATTTTGTCCGGCGATCCGAGGTCGCGGCCACAAATACATTACGTAGTTCCCGTTCTGCGTCCTATACGCTAAGGATGGAGACCGAAGA
ACTGTCCGCATCCTCCACGTGAATGGGCCTCATGGCACGCACTGGTTTAGCCGGTGTTGGAGAAGCCGTGGGTGCGGGTCGTGGTCGAAATTATTCGATC
GCATGAGTGATTGATTTTTTCGACCTTCCATGCGCTGGTAAGCGAGTAGGGTCTCCTCCATATCATCCAAATCCCGATTTGTAACAGCGTCAGTAGCTTG
GCCAGATCGCAATCGCCCAAGGTCCCAATAAAATGTTTTACATGTTCACGACGTATGTCTGGGGATCCATCTCGAATTCGTATCTTTTTTCTATTCGCTG
CCACATTCAACCGACACAGGTAATCCAGAGGCGTCTCCTCCGGTTGCTTCTTGTCAAGGTAATATTGTCTCCAAACGGACATACCATCACCACCATATTC
CACGAGAAAAGTTTCCTACAGGTCCTTTTTACGAATGGAGAGTGAATCGGCTCAGCTGACTGTGCCAATTTCTCGCAGGACCCGTAAGCAAATCTCCAAA
TACCAAGCATTCTCCATATCTGGAGCTTGATCGCGTAAGAATGCAGACTTGACCTTGCCAATCTAGCTCCTGGCTCGATCTTCGGCTTTGTCCTTTCTAT
TAAATTCTTTCAGTCCTGCGATCGCAGACATCCGAATCCGTGGGGCGCTAAGTCCACCACCTGGCACTGTCTCCGCAGTAGCAACAAGTGGTCATCTCGA
CTCATCTTGCCCTGAGTTGTTGGGATCTCCTGCTCCACGATAGTGCATTTAGCGCCACAGTGATGCGATCCGACCGATTCCATTTCAATATCAGGGGTAT
AAAACTCTTGATCCCTTGCAACCTTGATCCGCTGACTCGGGTAGATTGCTTGGCAGGCCTGATTACGGTGTTCCTGCTGAAATCGTTCCATGTCAGCATC
GAAAGATAATTGTATTGTCCTTTGGTAGTCGAACCCGTATCTTCTGTAGCGCTACGGGTGTCGATCGCGGTCCGCTCTCGATCCCTTTCCCGCAACCATG
TAGATCATCCTTCTTTTACATGCGATCGCGTAGATGAGCAGCCCCACTTTGTTTAAAGACATCCGCTGAAATGCCGATTGAGTCCCCTGACTCTACATTA
GACTCGGCTGAGGCATACTGGAACGATTCAGTGTGATATTCTCTCTGAACTCCTGCAGCCGTCGGTACCACGTGATCGTTCACCGTAGTCGCTTCCGCGT
GATCGTTAGCTTTACGTATGCCCGTCAAAGGGACTATTTTCTCATACAGCGATTGACACACGTGTATCATGCGATCCTGTTCGCAATCCAACAGCTCTCT
TGCGTCGAACGTTCCAGCGACGAATCCCGCTTCGTTCAGCAGCTGTATAATCCCAATGATTCCATTTAGTGTGTTCGACGCGATAACTGGGGTTGATATA
AGGCCTTGAATTGTTCCAATCATCTTGGGATTCAGTATCCGGAGCACAATATCGCTCGACAAGCACTGCTTATGCGTTCTCCAGTGATATATCTCTGCCA
TCTGGTCCAGTTGCCAGTCTTCCATCTTCTCTCATCTTCCACAAACTTGATTGGTCTGATGGCCGATCTCGTCACGCGATAGGGTTGATCCGATCCTTGC
GCTGTCTTCTTCACTCGTGCAGTCTTCGACTTCTTCATTTCTTACGTCGCATGAGTGATCTTGGATGAACTTTCTTCGGTTTTAACCCAGCGAGTCATGC
TTTGCAGCATGATCCGCGGTGTTCCCG