Description :
From Genome Similarity Track
Location :
contig_95:4483- 7852
Transcript NameFunction/comments
g13317.t1hypothetical protein

Sequence
3369 bases(100 bases per row)
TGCCCCGCTCAGGCGAGTTTCTGGAGTTTGGATTGATACTCAGCGAGAGCAGGGTCTCAACTGGACCCGGCTGGGCCGAACCGCAAAGAGAACCAACAGA
ACCCTGCGCAAGCCCAGCAGCGCCGACCTGACTTGGCGAATTGCTGTGTTGTTTCGTGGAAGCCGCACTAACGACGTTTTCTGTTCATTGCAACACCACA
GACGTCATTGCCTATGCCCATGTGTGGATCCGTTGTCAAAGTGGAGGGGTCTTCTGCCACGATTGGACTTCTATCGTCACCACGCGTGACCGTTCAAGTA
CCCGCAGCAACGTTGTGTATACGTCGGGTTGACCCAGACAAATTTGAGGTAGGATCTCGAGGAATATGGCTTCGCAAACCGATCGTAGAAAAAAAAACAG
ACGGTCGCTATATCTACGGTCAAATCACAGCGTATTTTGATGTTTTGCAATTATTCGTACCGGCCGGGTACCGCAAAATCACTCGTGGATGGAATCATGG
AAGTACCGCCGGTGTTATACTTCCTACAATCTAAGTTTGAGGGCGATCTTGCTGCGATAACACTAACCGTACTGCCCAAGAAGCACGAGTTGGAACTCGA
CCGCCTCCTGGGCTGAAACACACAGACACAGACCCGAGCCATCCTACCGCTGCTGTATTGACTGGAGATAGAGCTGCTCGTACAATCATCTGTCGCGTCT
CGACATGGCCTTCCGAACTGACTGCACCTTCATCTTGCAGCTCTATTGTCAAATCCTCAGCTTCTTTGGCCAATATTTCCGCCGAATAATGACAAGTCAA
AGCGTATGCTATAACTTCCTCGGGCTTCCCCGTCTCGTCTTCTCGCCACACCAACCAATTCTCGTACCCTGTAGACTCTATGATTCTCATCGGTCCCATT
CAGTTACGCACAAACTTGGTGACATTGGGCCCGCGTGGCGGCCTGTACAATCATACTCGATCACCAGCCTTCCACTCTCGCTTCTGCTGTACACACCTGT
TGTAGTACTTCGCCTGCCTTGCTTGATCTTTGACACACGCTTGATCCGCACACTTACCACTCTGCAACAACTTCTTTAGCAACTTATCGTGGTACGACAT
GAGATCACCAGCTTCTCCGACTGCCATCCTCCGCAACTCATTCGGAGACTTCAACTTCCTGCCCATCATGAGCTCATTTGGGGTCAGCGCTTTGGTAGAG
TGCCTCGTCGAGTTATACGCATATACATCGTACTTTACTCACAACTCCCAGCCTGTCTGGTTCTCCTCCGTCATGGAAGTCACTACGCAGTATGTCCACG
TTCTATGGAAGCTTTCAACAAAGCCGGTCATCTGTGGCCGATATGGTACCAGATTGATCTGTTTCGACTGCATCAACACCACTAGCTGTTCTATCGCCTT
TCCAGTGAGCTCAGGAGCTCCGTCAGCAATTCTAGAACTGGTCTGAATCGTAGCACCGACTCCTTCAATAAAAATCAGGGATGTTAAAAGAAAGCCTCCT
GAAAAAAGAAATCTTCTTTCGATTATAAAAAGATAAAAGAAGAAATCGTGGGTGTTTCTTTTAATGGACCCATGCATTTTCGAACTCTACAATACCAACT
CCTGCTCAATGTTTCCGTTGTCATTGGAGTTGCTACTGCCACTGTCCTCGTCTTCGGTGTCACCAATGCTGATGACACCTTGTTCGGCGTTGGGTTCTTC
TGTTATAATTTCGAGCGCCTAAGAATAGCTGCAAAAATCAATCTATAAATTGTTATAAGAACAAAAGAAGAATTTTGTTCGTTTTGACCAATCTTTTGTT
GCATTAAAAGAAGATAAAATAAAGTTGAATACAAGAAAGCTTACCATCCCTGGTAAAAATGCTGCAACACTCTTCGCCGTGTGCTCCATCACTGTAGCTG
CAACAACGTATCGATTCACATACTCGAGAGTGGCAACGACGTAACGCTTCCTTCCAGTCGCTATTGGAAACGATCCAGACACGTCAAGCGCCCATCTGTC
ACCAACGTATCCGCCTCGTAGACTTCGAAGACGGGGTACGACCTCGCACGGTCGTACTTTCCTGCTCCCGCACGCTTGGCAATTGTTCACCCAACACCGT
CCTTCCTTCTGCATTCGCGGCCACCAGTAAATCGTTACAATCCTCGCAACTGTTCCGCCCACACCGAGTCGTGATATTCCTTGAACACCTTTGGCTACAA
GGTTGGCGGTAGGATCACCCTTCATACCATGTGACGTCTGGATCAACGCCGAGCCGTCGCTTTGCGTGACCTCCATGCCTCGGTGCTTGCTCGCCTTCAA
CTGTGTCTGCACCAACTTGCTGTGTCCTTGCGCCTCGACGCTCTCGTCGTCCGTCAACTACTGCAAAGTATCATTCTTGTACGTTGGCACCGACTTGGCT
CATCATCTGGGGTCATCTCCTGATGTTTAGACCTCTGTGTTCGCGTTCGGTGTTGCTTGCCTGCCGTCGTTTCCATTCGCCGGCTCGCATGAACCTACCG
CGGCTACAGTTTCCGCATTGTTCCACGTGTTGTATTCGTCGCCACAGCTTCACTATCATTGTTCACTGCTCGCGGTCGTTCAACACCACCGCTCAACGTC
TTCGGGTCTTGCCGTTCGCCGGTTTCACTCACTTCTCTGTATTGTACGTCGTCACTGCTCATCAATGGTCGTACGTTATCCGGAATTGGTATTGCTGCCA
CCAACGCCTGTACTGGTTCTCGTTGTGCATTTTCTTCTGTACGCCGCCTGGCTGCTCGCGTGAGGGGCCAGCATGTTTCTTCGTGCGTCCCCTTTCCGAC
TTTCGTGCTCTTGTCTGCTGCCGTCGATTCGTCCTTCGTCCGTTCCCGAGTTCTGGTCGTATCTGGTGTCATCGTCTGCGTATCTTAGGTTGTCTTGTGC
AGCATGGCTTCGTCTGCTGCATCTGCTTGCTTCGCCATCGAAGCCGCACCTACCGCTTCCTGCAGTTGCCGTCATTGCTCGCTGCCTGGTGGCTCTCGAC
ATCTTGCCCACCCCCCGCCAATACTTCTGCTGGCGTACACGACAGCGGATCTGCCACTGCATTCGTTCTGCTTCGTCTATAAACAATTTCAAATCCATAC
TCCTGTACAGCCTATGCAGTCTACCTGCTGGACTTGGTCTTGTCATCATCACGTAACTGCGGACGTGATAGCTCCCCCTTTTACGCCCGCGCTCCATTTC
CCGTTGTCCTGGTTGCTGCACGCTGTTTCAAATACGCGTTGTTGCGCACTATCGCTTCCGGGTCTGAACACTTGTCAGCGAAGTGGCCTTCACACGTAAG
CACCTGTTGTCAAGTTTCCTGCCGCCTCGAGCTCCGTTGCCACGCAGCCTCTGGGTATCCGTGCTGTTG