Description :
From Genome Similarity Track
Location :
contig_95:4483- 7841
Sequence
3358 bases(100 bases per row)
CAGGCGAGCTTCTGGAGTTTGGATTGATACTCAGCGAGAGCAGGGTCTCAACTGGACCCGGCTGGGCCGAACCGCAAAGAGAACCAACAGAACCCTGCGC
AAGCCCAGCAGCGCCGACCTGACTTGGCGAATTGCTGTGTTGTTTCGTGGAAGCCGCACTAACGACGTTTTCTGTTCATTGCAACACCACAGACGTCATT
GCCTATGCCCATGTGTGGATCCGTTGTCAAAGTGGAGGGGTCTTCTGCCACGATTGGACTTCTATCGTCACCACGCGTGACCGTTCAAGTACCCGCAGCA
ACGTTGTGTATACGTCGGGTTGACCCAGACAAATTTGAGGTAGGATCTCGAGGAATATGGCTTCGCAAACCGATCGTAGAAAAAAAACAGACGGTCGCTA
TATCTACGGTCAAATCACAGCGTATTTTGATGTTTTGCAATTATTCGTACCGGCCGGGTACCGCAAAATCACTCGTGGATGGAATCATGGAAGTACCGCC
GGTGTTATACTTCCTACAATCTAAGTTTGAGGGCGATCTTGCTGCGATAACACTAACCGTACTGCCCAAGAAGCACGAGTTGGAACTCGACCGCCTCCTG
GGCTGAAACACACAGACACAGACCCGAGCCATCCTACCGCTGCTGTATTGACTGGAGATAGAGCTGCTCGTACAATCATCTGTCGCGTCTCGACATGGCC
TTCCGAACTGACTGCACCTTCATCTTGCAGCTCTATTGTCAAATCCTCAGCTTCTTTGGCCAATATTTCCGCCGAATAATGACAAGTCAAAGCGTATGCT
ATAACTTCCTCGGGCTTCCCCGTCTCGTCTTCTCGCCACACCAACCAATTCTCGTACCCTGTAGACTCTATGATTCTCATCGGTCCCATTCAGTTACGCA
CAAACTTGGTGACATTGGGCCCGCGTGGCGGCCTGTACAATCATACTCGATCACCAGCCTTCCACTCTCGCTTCTGCTGTACACACCTGTTGTAGTACTT
CGCCTGCCTTGCTTGATCTTTGACACACGCTTGATCCGCACACTTACCACTCTGCAACAACTTCTTTAGCAACTTATCGTGGTACGACATGAGATCACCA
GCTTCTCCGACTGCCATCCTCCGCAACTCATTCGGAGACTTCAACTTCCTGCCCATCATGAGCTCATTTGGGGTCAGCGCTTTGGTAGAGTGCCTCGTCG
AGTTATACGCATATACATCGTACTTTACTCACAACTCCCAGCCTGTCTGGTTCTCCTCCGTCATGGAAGTCACTACGCAGTATGTCCACGTTCTATGGAA
GCTTTCAACAAAGCCGGTCATCTGTGGCCGATATGGTACCAGATTGATCTGTTTCGACTGCATCAACACCACTAGCTGTTCTATCGCCTTTCCAGTGAGC
TCAGGAGCTCCGTCAGCAATTCTAGAACTGGTCTGAATCGTAGCACCGACTCCTTCAATAAAAATCAGGGATGTTAAAAGAAAGCCTCCTGAAAAAAGAA
ATCTTCTTTCGATTATAAAAAGATAAAAGAAGAAATCGTGGGTGTTTCTTTTAATGGACCCATGCATTTTCGAACTCTACAATACCAACTCCTGCTCAAT
GTTTCCGTTGTCATTGGAGTTGCTACTGCCACTGTCCTCGTCTTCGGTGTCACCAATGCTGATGACACCTTGTTCGGCGTTGGGTTCTTCTGTTATAATT
TCGAGCGCCTAAGAATAGCTGCAAAAATCAATCTATAAATTGTTATAAGAACAAAAGAAGAATTTTGTTCGTTTTGACCAATCTTTTGTTGCATTAAAAG
AAGATAAAATAAAGTTGAATACAAGAAAGCTTACCATCCCTGGTAAAAATGCTGCAACACTCTTCGCCGTGTGCTCCATCACTGTAGCTGCAACAACGTA
TCGATTCACATACTCGAGAGTGGCAACGACGTAACGCTTCCTTCCAGTCGCTATTGGAAACGATCCAGACACGTCAAGCGCCCATCTGTCACCAACGTAT
CCGCCTCGTAGACTTCGAGGACGGGGTACGACCTCGCACGGTCGTACTTTCCTGCTCCCGCACGCTTGGCAATTGTTCACCCAACACCGTCCTTCCTTCT
GCATTCGCGGCCACCAGTAAATCGTTACAATCCTCGCAACTGTTCCGCCCACACCGAGTCGTGATATTCCTTGAACACCTTTGGCTACAAGGTTGGCGGT
AGGATCACCCTTCATACCATGTGACGTCTGGATCAACGCCGAGCCGTCGCTTTGCGTGACCTCCATGCCTCGGTGCTTGCTCGCCTTCAACTGTGTCTGC
ACCAACTTGCTGTGTCCTTGCGCCTCGACGCTCTCGTCGTCCGTCAACTACTGCAAAGTATCATTCTTGTACGTTGGCACCGACTTGGCTCATCATCTGG
GGTCATCTCCTGATGTTTAGACCTCTGTGTTCGCGTTCGGTGTTGCTTGCCTGCCGTCGTTTCCATTCGCCGGCTCGCATGAACCTACCGCGGCTACAGT
TTCCGCATTGTTCCACGTGTTGTATTCGTCGCCACAGCTTCACTATCATTGTTCACTGCTCGCGGTCGTTCAACACCACCGCTCAACGTCTTCGGGTCTT
GCCGTTCGCCGGTTTCACTCACTTCTCTGTATTGTACGTCGTCACTGCTCATCAATGGTCGTACGTTATCCGGAATTGGTATTGCTGCCACCAACGCCTG
TACTGGTTCTCGTTGTGCATTTTCTTCTGTACGCCGCCTGGCTGCTCGCGTGAGGGGCCAGCATGTTTCTTCGTGCGTCCCCTTTCCGACTTTCGTGCTC
TTGTCTGCTGCCGTCGATTCGTCCTTCGTCCGTTCCCGAGTTCTGGTCGTATCTGGTGTCATCGTCTGCGTATCTTAGGTTGTCTTGTGCAGCATGGCTT
CGTCTGCTGCATCTGCTTGCTTCGCCATCGAAGCCGCACCTACCGCTTCCTGCAGTTGCCGTCATTGCTCGCTGCCTGGTGGCTCTCGACATCTTGCCCA
CCCCGCCAATACTTCTGCTGGCGTACACGACAGCGGATCTGCCACTGCATTCGTTCTGCTTCGTCTATAAACAATTTCAAATCCATACTCCTGTACAGCC
TATGCAGTCTACCTGCTGGACTTGGTCTTGTCATCATCACGTAACTGCGGACGTGATAGCTCCCCCTTTTACGCCCGCGCTCCATTTCCCGTTGTCCTGG
TTGCTGCACGCTGTTTCAAATACGCGTTGTTGCGCACTATCGCTTCCGGGTCTGAACACTTGTCAGCGAAGTGGCCTTCACACGTGCACCTGTTGTCAAG
TTTCCTGCCGCCTCGAGCTCCGTTGCCACGCAGCCTCTGGGTATCCGTGCTGTTGCTA