Description :
From Genome Similarity Track
Location :
Scaffold_259:44811- 52810
Sequence
7999 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCCCACTTGGTAGCACTTGTTGGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAG
CTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGCTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGTCCTGCAGA
GCTTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGC
TCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGCCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGA
GAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGCGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTCGGGTGT
ACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCATTCCTCCCGGCGAACTACGAGTACCGCCA
GCTTCCTCGCGTGTAAACAAGGGAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAACGAACA
CATCAAGATGAATGTGTTCATGGACGGCCTTCGAGTCGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGGCGATTCAAGTGGC
TCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTTGGAGTTCCTTGTCGGCTCCCAGTCGAACAAGCCCCAACGGACCA
GTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCCGCTGTGGGAAGATGGGCCACTTCAAGCGTGACTGCCCCGCGGAAAGACTCC
GCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCT
ACTGGGGAGGAACTAAGTCTTCGAGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCA
GCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCA
GGCGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACT
GTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGG
GCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCA
TGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACTAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCC
GAGGATAGTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAAATTAGGTCCACAGGTGGGTAACTTAGTTCCGCAGACAGCTGCAGCTG
TCATGACCACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGCTGAACACGCTTCCTG
TGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCC
ACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTTCCCGTCACAGACGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGT
CGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTT
CGATGGTGAGACGGGCTTACCCGTCAAGGCATCTGGTGCCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAG
TCTTTCCTGACCAACCTCAAGGCTGGAAAGATTGCTGAGATGGTACTCATACGACCTAAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACA
AAAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTGTGAGATTCTTAAGAACCCCAAGGATCCGGTTTATCCTTTGGTGACGAAGTG
TGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACG
AGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACT
CGACGCCGACTTTCTGCGTTCGTAAACCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAGCAACGCAACGGTGCCGGCCCAAACACCAAT
CCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGCGAGAGT
GACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGATCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCG
TGGTGACGCAATTGTTCCGCCCTTTAGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGACCATGG
AGGTGCATCTAGGACACATCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGCCAAGTGCGTTTCGCGTTACCAGAGATTAAA
GTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTC
GAAAGTGATTGGGCTTGGCCAACTACCTTTACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCATAAGGACGTCGACTG
GCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGC
GTCGTCTGCGATGCCTCCAATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCA
AAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAAAATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTT
TGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAAC
TTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGG
ATCTATATGATCGTATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCATCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCT
TTCGTCGCGACAGCGCTCACGACTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCC
AACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGACGGTCTCTCAGT
CCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACT
ACAGAGCCTGCCCGTACCGGCTGGTTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGGAATTTTGGT
GTTCGTGTGTCGGCTGAGCAAGATAATACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGC
TATCACGGTCTCCCAGAGACGATTGTCTCGAACCGAGACCCGCGGTTCACTGCCGCGTTTTGGAAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAG
ATGTCCATCGCGGACCATCCGGCAGACAGACGGCCAAAACAGAGCGCGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGTACGTGGTCGACG
CAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTACACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTC
TCACTCTTCGAGGAGACACTGACTCCTCTACTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCG
AAAACAGGTGGAATCCTTTATGGACACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGAC
AAACAAGGTAGAGGAAACTTAAGTATATTTGAGGGTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGTAGCA
ACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGAC
GTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGCCCCAGCTCCTCGAAGCGAGGGCCGGTCACAG
TCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGACCCCG
GCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGA
TCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACTCGCAGGTGCACTCGCGACCTCTCGCTCCACCAGGTCCAGGC
GACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGATACGTTG
ACGGAGACGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAG
GGCACCTCTGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTG
AAGTGGAGGGATTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGC
GGCAGCTTCATAAGTAGTCCGGGGCTTTTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGC
TTCAGGATGTCCCTTGGCAGCATACGTTTGCTGCTCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTTCAGGATGTGGGACAGCTGCTGATCTTCAT
GGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAAC
CCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGC
ACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTCGAAGTGTGGCCGCCCAGAAGGCCAC
GAGGAGCGACGAGAACCGCCAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGC
CGCCACCGAACCCCCACGCACACGCTGGACAGCTTGGAAACCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCC
TCCTCCTCTACTTCGTCCTTCTCCTCCTCTTCATCGGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGCCTTAG
AGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTC
CTCATCGCCACCGGCTTTGGGAACGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTTGCGGGC
GACTGCACGGTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCTT
CACTGCCCGAGTTGAGCTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCAC
AGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCC
TTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGG
TTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAGCACC
TCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGCTACATGAAGTGTGACACTTC
ACACTCCAGGACTATGACACGTCATACTCCGGGATATTTGGTACAAGGCACCAAGGTCGTTCAAAGCCAACCATTGGCTAAATGACATTGCATTTCTATA
GGTAACTAATAGTTTGTATTATTAATAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTA
ATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACATA