Description :
From Genome Similarity Track
Location :
Scaffold_1122:4481- 6522
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1122-snap-gene-0.1Folate-Biopterin Transporter (FBT) family

Sequence
2041 bases(100 bases per row)
GCTCCAGCACAAGTCGTTCAAGTCGCTCGCTCGCCGGAGATAGAAAAGCCATGAACCGTGCGGCCAACGATAAGGTTGAGATCGCCCAGCGCGTGTCGTA
TATCAGCAATGCGTCGAACGCCAAGGACACCGAGAACGGCTACGAAGGCGCCAAGACCCCAGATGTCTTGGAAGCCCAGGGTGGTGCACTCCGTGCTGGT
GGCGCTCCAANNNNNNNNNNTGGCCTCATCATACAGTATGCTGCCGTCGGTGTGGTCTATGGCTCGCTGCCAGCGACGATCTACCCATTCTTGCAGTCGT
ACCTGAACGCCAGTGGTACCCAGATCGTGACGGCCGGTACGCTCGTGGTGCTGCCGTGGTCGTTCAAGATCTTCTACGGCATTGTCTCTGACTGCTTCCC
GATCTATGGCTTCCGCCGTCGACCGTACATGCTCATCGGCTGGAGTATCTGCTTCTTGATGCTCATCATCATGGCTGCGACGCCCGTGGGGAAGCCGTAC
TTCTTGAACCCCGACGACGCCGACATTGACCCCGAGGAATATGATCAGTACCCAGGCATCGAAGACCGCTTGAACAAGAGCGCGCCGAGCAAAGCCGGCA
AGTACGTGCTGCTGATGATGTTTGCCGCGTTCGGATACCTCATGTCGGACGTGACTGCCGACGCCATGGTTGTCGAGCTCGCNNNNNNNNNNGCTCCTGG
GTTGGGGTATCTGCTTCGTGATGCTATTCATCATGGCCGTGACCCCAGTGGGCGAGCCGTACTTCCTCAACTCAGACGATGCCGACATTGCACCAGAAGA
CTACGCGTTGTACCCTGGCATTGAAGACCGTCTGAACCCGAGCGCCCCCGGCAAAGCTGGCAAGTACGTGTTGCTGATGATGCTCGCCGCGTTCGGGTAC
TTGATGGCCGATGNNNNNNNNNNGATCCTCGCGATCTGCTTGGTGCCGGTGTTGCCGATGACGTGGTTCTACATCAAAGAGGAGAAGCGCGAGCGCCTCG
TGTTCACCGAGTACATGTCGGACCTCTGGAAGCTCATCCAAACCCGCGCGATGTATCAGATCATCTTCTACAACTTCTTCAGCGGCATCTTCTCGAGCTT
CTCGTACACGGCGGCGTCGCCTGTACAACGGTACATGGTCGGCGTCGAGNNNNNNNNNNCACGACGCAGTCGACGATCTACGCCACGCGTACGCTCTTTG
TTGCGATCAGCACGATCCTCACGGGCTTTGCGTTCAACGGCAAGGAGTACGGTGGCAGCTTCGATTTTTCGCTGAGCTTCCCGACGCTCATGCTCATCCT
CGCGATCTGTTTGGTGCCGGTGTTGCCGATCACGTGGTACTACATCAAGGAGGAGAAGCGCGAGCGCCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNTTT
TTCGTACACGGCGTCGTCGCCTGTGCAGCGGTACATGGTCCACGTCGAGCCNNNNNNNNNNAGTGATGTCATCGGGAACCTCGTGTTCTTGGCCGGTATC
ACGGTCACGGGCAAGTGGGGGCTCAACTGGAACTGGCGCTGGATCATCGTCGTCACAGGCGTGCTCGTGATCGCCCTGGACGCCATCGTGGCGTTCATCA
CGATCTGGGACGTGTTCCGCAGCCAGTNNNNNNNNNNGGGCATCCTCGTGATCGCCGTCGATGCCATCGTGACGTTCATCACGATCTGGGATGTGTTCCG
CAGCCAATGGTTCTGGTTGGGCGTGCCAATCGCCATCAACGTGCCGTCTGGCATCAGTTTCATCGTGGGCACGTACGTGATCGTGGAGCTGGCGACCGAC
GGCAACGAAGGCGCGGTCTACGGTCTGCTCACAACGGTCTCGAACCTCTCGTCGCCGTTCGCCGCGACGCTCACCAAAATCATCGACCAGAAGTGGAACA
TGACGAACGAGCGTATCCAGATCGACGACCACTCGATTCGCATGGACATCACCGAGTCGATCATCCTCATGTACGCCATGTCGGTCGTGTCGTGGTTCTT
CCTTGTGTTCCTGCCCAAACAGAAGGCCGAGACGCAGGAGC