Description :
From Genome Similarity Track
Location :
Scaffold_644:448- 5396
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_644-snap-gene-0.7U-box domain/leucine-rich repeat protein

Sequence
4948 bases(100 bases per row)
CTCCCGGTCAATTCAACTTTCCCGTTCACACGTTGAACGCGGCCAGCAAAAGCCCCGAAGCCGGCGTCTTCTTGAAGCGCTGGGTGGTCGCCACGTCCCA
GGGTGCCTCTTCTACGGGCTCTTCTACCGGTACAGTGCAAAGAAGGATTTCGTGGGGTGATCACGCTGGACGCGTATGCGACATCCAGCAGCTCACTAAC
TTCTGGGTCTCCTTTCTTTCGCTCCCCGACTTAGTAGTGCCTTCGCAATCGCTTCAGGATTCCGACGGAAGCGGTATTATATTACTACCAGTAGTCGCTC
GCGAAATCCACCCCTCGTGAACATGCGTCTCGCCGTGCTGCGGGCCGCGCTCGTGGCGCTGGCGGCGCGCAGCGTCACGGGACAGGTCCCGTCCCCCAAT
ACCACGCCCCCAGCGGTCGCTCCTCCTCACAACTCGTCCGAGACCATGGCGGTCGCCGTGACGTGCGAACTGCTCGGACTCGTCTCGGTGATCGTGCGCG
GAGCGCCCAACACGTTCTGCGTGGCCGCGAACACGTGCAACACCAACTACATCGGCAGCTGCCCGGGCTCGAGCGCCGTCGACAGCAAGGGCCAGCCGCT
GGCGTCTGGAAGCTGCTGCGCCGCGCTGGAAAACACGGGCGACGTCGGCTGCGTCGCTCTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGAGCGGCGCCTTCCAGTGTCTCAAGCACGCCGGCAGCAGCGATTCCGCTGTGGTTATCGACATCTCCAAGGCCACGCCGCCGCCCACGACCACNNNNN
NNNNNGCCGCCGTCCACAACCAAGGCGCCCGTGACGATCAAGACCGCAGTCGATGGTTCCCGTGAAGACGCGGGCGAGACGTCCGCGCCCCCGACAGCAA
CGACCACGACTCCGAAGCCGACGCCGTCTTCTCCAACGACCACAACAGCGACGCCCAAGCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCCGGACTCCTCATCCTCCTCATCGTTGTCGTCCGGTTCGTCGTCTCGGTCCCACGAGCCTCCTCAGGTC
GGTGACGAACCCACGATCACTGCTCCGCAAGTGGTACCTCCGACGACGACTCTTCCGGCCCCCACCGGTCCGCTGCAGGCACTCGCTCCAATCCCTGATC
CGCCGCGCCCGTCGTATTCCGGAGAAGACCGCAGCAGCGACCACAAGACGACCAGTAGCTCCAGCAAGAGTCCCGTGCCGTTCAGTGGGACCGGCGAGAG
TTCGACTTCGAGTGGCAGCTCGTTTGCGTCCGCGATGAGCGGGAACTTTGTCATCGTCATTGTCCTGGGCACGGTCGCGTCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCGTCGTGCTCGGCGCGCTCATGCTGCGGCGGAATTCTTCGGGCAAGTCGTCGTCCGCGGCGTCCTCGGCCCCCACGAG
GTCCTCGGCAAGTAAACTCGTCTCGCCCGACGTAAAGCCCACACTAACTCTCGACGGTGATGAGGAGCTCTTCGAGGATCTCCAGTTCCGACCATCGGCG
CATTTCTCGCCCATCTTCGTACAGCCCACGCACACGTACGCCGAGACGCGGTCACCCGGCCACGACCGACAGTCGTATTTACTTTAGATTTTACAGACGA
GAGAGTTGGTGCTTCCGACTGATTGCACAAAAAAGGCTCATGTTTATAATACAATCGAGTTGCGTTGTAGGTTGAATGTGTGATTTGTGTTTTTCGAAAG
AGAGAAGTTGGGAGAGCCGACGGTGGCCACTTGGGGAAAAAAAAGAGAGAACAGGAAATGGCTCGATGCCTAGATGGACGACTCAGAGAGAANNNNNNNN
NNGCGCGCGTGCTTCTTCCGACCGCTTTAACATGCCAATGACCCGCTGCTGGAAGTNNNNNNNNNNCCCATGCCACTGCCGCACTGCTGCTCGGGGCACA
CTGCGTACACAATCTGTCGCTCCTCCTGGACACGCTGGAAGCCTACAGAAGCAAATTGAGAGAGTGAGACATCTGGGCCAGAAAAGTGCGGAAGTCAAAA
CGTACGCTGCTTGAAGAAATCGTAGGCAGCGCCAGCGTCGAACCCCGACTCCTCTTGCTGAAAGCTGCGACGGTGCTCCGCGCGTGCTGCTTCCGACCGC
TTTAACATCCCAATGACCCGCTGCTGGAAGTCTTCAACCGTGCTCTCTTCCGTGTGGCACAACGCGCTGCGATCCTCGTCATCGTCGTCTTCTTCCGTGC
CGCTCCATTCGTCCGCCAGTGCGAACGGTTTGTCGAGCGAGTCCACGTGGGTGGACAGGCGAACTGCCGGGTTCTCCGATTCGTCCTGGTTCGAAAATTC
TGGCACAACGGGGCACTCAACGTCTCCAATGACAATAACATCGGTCGCCGCATGCACAGCGGCCACAACCTCTTCCAGCTGAGTCAATACTTCTTGGCAG
ACGCCAGCGTCCAGTTCAGCCGAGCGCGCTAAGTCGTGCGGCCGGTGGAACACTGCAACGTCTGAGTCCATGCTGTCCCGACCACACTCCTGGTCACCTT
CAGCGAGGACTGCCGCGACGCGCGCGTCCGCAGCTGCCCGCTTGCGGTCAACACCCTTCTCCTTGCGCTTTTGCTGCTTTTTCGCCGGCTGTGGGGCAGC
GGGAGCATCAACCGGCACATCACACGATGGTGCCGGAAGCGCAGCCTTGTCGGTGGTGAGCGTCTTCTTCTTGTTGTTCTTGGGGTGTTTCATGAGAACA
ACACCCTTGGTCTTGTACACAGAGCACTCAATCTGAATGCGCGCCGGCATCTCAAAGCGCCAAGCGAAAGAGGTGCCGCTGCCCAACGGAGGCGTGGTGG
CCTTGACAAATGTTGGCTTCTTCTGCTGAGATCCGCGCATCATTAGAGACGCCTCGAGCGAATGCTCGACCATGCCCAACGTTTCACCACTCACTCTCCA
CACGACCACGTCGCCTGGTCGGATATGAAGCTGCGGTGGGTGGAACGCAAAGTTCTCGATGAGAACCTCATGGACTCGGAGACCTTGTTGCTTGCAGGCG
TCAACATCCGTCGTGAGCGCGAGTGGGAAGGGGACTGGGTAGAACACGTTCATCTGTACAGCAGTCGACAAGTCGGTGGGCTGGATCGCAGAGCTGGGAA
CAAGATTCTCAAACGCCGACATGAACACGGTCGATGCCTCGTCATCGTCCGAACCGGACTGCGTTTCCTGGCTCGACAATGCAGTCGCCGCGGCGGCGGC
GGAGCTGCACCAGTCCGTGGCGATCGGTTGTGGCTGGACTGCTGTCTTGGAAGCCTGCAGCTTGCGCGAGTGTCGTTCACTCACTGTGTACGCCATTTCT
TCCTGTTCATCCCGGTCTTCCACGCTCGGCCGAGGACTTCGCTTAGGCTTCATCTGCTTGTGGTGGTGCTGCTTACCTAAGGCTGCTGGAGAAAGAGCAG
GAGGAGGGAAGCCTACATCTTGCGACGCAGCATCCACCGGCGACGAAGGTTTGGCTTTCCACAGGAGCTGTTTCAGCAGACTCGGTCCTTTGTGCTTGTC
GCTGTTCACGTCGCTCTTGCGCTTTCGATTCGAGGTCGGCTTTGGTTTCACGAGTTGCACGTCTTGGTCCACACAAATCTGTTGCGAAGGAGGCTCCTCC
GCCTCGGCCTCCTTGTTGTCGTTGTGGTTGCCCGACAGCTGCCGCTTCTTGAGCTTCTTCTTGGGTACAGCAACAATCTCCACCGCGCCACCAGTCGCTT
CCACAGACGCCTCGTTCGATTTCCCGGCCGCCTCCTTCGCGTTCGCATTCGCCTTGGGTTTCTTCTTCCGCGCCGCGCCGCCGGGATTCAGGGGCTTCTG
CTTGAGCGTCTGCGGACGCTCATCGCGCTTGACGTGATCGTCCCCCACGACTGGCTCGGCCTCGCGGTGCTCCATTTGGTTGTCTCCCTGCTGGTTCGTC
TCCACGGCAACGGGCACTTCTGCGGCCGCGACAGCCGGCGCCGACGGCACTTTGCGTCGGTACCGCATCATGGGCGCAGCTGATGAGATCACTGTAGCCA
CATGGAGCAATAGACTTACGGTCAGCAAATGGACCCTCTAGCGAGCGACAGAGAGAGAGAGAGAGANNNNNNNNNNTCCGCACCTTTCTCGGGTGTCTTG
CCCATGGTTCTCTGCTGGAATTTCTTTCGGGTGCTTCTTCTCTTCTCGAGGCGCAGCGCGTGTGGTGCTGCCGAGCGGTCTCGTTCGTTTCCTCGCCCCA
AGCGTCGCGGCGTCGGGCGTTCACACTCGGCCTGATGAGCTGCAACGAGAGTGCCGCCAAGGAGCTGCTTTTTTGGCGGGGGTTCGTTTTTCAGGGCTCC
GATGTGGTCAAAAACCACTCAATAACCACCGTTGGGATTTTCCAAGAGCGTCGCATCGCCAGCGAATTAACCTCACGGCCCATAGTGAAACCAAGTGATT
ATGTGGAATCTTCGAAGATTCCACCGTTGGACACCGAGGTTTTGAGGTTAAATCATACGGGACACCGCGCGTTTTTTGCGAAGGCATGATTACTGGTCCA
AATACACCCATTTTCATCCAATCATAAGCGCTTCTGGAATGGGTACAAGACTTCAAGGTATCTTCTCCTCCGCTGTGAGAAGCGGGAAGAGCATTTCGTC
GGGCTGCGCCGTGCAGTCCACACCCGGCGCATGCAGGTCCTTGGTCGCGGTGTCGAGGTTGTTGCAATAGGGCGTCGCGCCCATGAGCACGCGCCGACCC
GGTTTAGCCGTCACCCAATCGGGAATGGTCCGTATCTCAGTCCCAACCAGCGCCAACAACTGCAGTGGCGTTTCGACCACGTCGCTCGGCAGCGATTTGA
TCGGGTTACGGCTCAGCGAGAGCTCGACGAGTGCTGGCTTTGAAAGTA