Description :
From Genome Similarity Track
Location :
Scaffold_976:448- 4301
Sequence
3853 bases(100 bases per row)
GATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGAT
CTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAAC
CATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGACTACGGTAG
GTACCCATTTCTCGCCCCGAGTGACCCACCGTTTCTCATGTTCCACCCACTTCAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGT
CTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCC
AGATCCAACCTCACTCCAGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAAC
AACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCA
CCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTG
GCTTGTCTGAACCACTTTCCGGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATC
CAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGATTCTCCCAGTAACCACGTGTCTC
TCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCA
CGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCG
GATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTG
TAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCATACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACT
TCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTTCGGGATCCGCACTGTGAATTTGGAAAACCTGAAATTGTGGTGGCCCCGCTCCCGGA
AAAATCTCCGGAAATTGTTAAATCTCCCCGTTTCCCGCGGGTAGGGTTATTCTCTCGGGTGCGAGAGTGGTTCCTGGGTTCTCCCCGCCTTCAAATGTCT
TGGAAGGCGCGGGAAAAAGACACGCAGTTAAACTCTCCGGGTCCAGATCCGCAACGCTCGGAATCTGAATCATTTCTGAGTCGGCGCCGTGACTTGGTGG
ACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTGGCGATACTGCCGGATTCGACGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCA
GCACTTCCTCAAGCTCGTCTGCGTTGGGAAGTCGTAGCAGGGTCAGCCTGTTGGCCAGATCCTCGTCTCCCAACGTTTCGATGAAATGATCCACGTGTTC
CCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAACGGGGATTCATCCGATCTG
CGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATC
TGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGA
CTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATC
ATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGT
CCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCG
ATTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGA
TTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGAT
CCCGAGCTTTCACGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCTAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTC
GGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGGTCCATAGTGCGCGACCTT
TCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCTTCGAACACACCAG
CTACGATGCCTGACTCCGTAATTAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTC
GATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCAAGATCCTTGTCGGACCAT
CCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTTTTCTTTCTTGTTTCTTCGACTA
GCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGCATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACT
TGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAG
TTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCA
CTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATTAGCAAAATCTGCGAGA
TTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCG
TCGGTAGGGCGGATTCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGA