Description :
From Genome Similarity Track
Location :
Scaffold_14:448- 2569
Sequence
2121 bases(100 bases per row)
AGCCGAAAAGGCTCCCATAAGATAACAAAGCAGAATTTTCCTAGTTCAAGACACGTGTAAACTCTTCCGGTAAGTCCTTGCATAGGGCTGGACTATGCCT
GCCGTTGATACTCGAGAGGCATAACTTGTAGGGTATTGACTGGTTAGCGCCAAGAGATTAGGTCGGTCCGGGCAGGACAAAAGTCTCGCTACACGCGAAA
TAAAGCCCCGCAACTCAGCGGGCTGGTACGTCGGATAGCCCGGGTGCCGTAACACTTCTAGCTGAGCAGCCTCTGCGTTCGGTGACCTGTAAAAGCGCTC
GCGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGATTGTGAACGAGCTCAGCCGAACCAAACTCGGCGGAGCCTCGGAAGTGCTCTGACTTGGTTAGT
CGGAGCTCAGTGGAAGCGAGCCACTCGTCTGTCCCCGCTGGGCCGAACCGCGAGGGGACCACCCTCTGCGCAGGCCATACAAACGCCGACCTAACTCGGC
GATTTGCTGTGGTTTGTGTAAGGAATCTACATCTGACGGTATTTGTGTGCTCTACTACACCACAAAAGTAAAAAAGGAACTGCTAGAATCCTCCAACGTG
CTTGCAAGACTACAAAGCAGCGTTCTATGTCCTTACGGTAACCCTCTTGACGCTTCACAAAATATCTATGTTTCATAATGACAGGGTGACTGATGGTTTG
AACGAATACCGACCAGTCTGGGTAATACCATCGGCCAGGAAGTAGGTCATGTAATATCTTCTACCTGTGAGCAAATTCGTTTAATAAGACCTAATATTCG
CATTTAAACGAGTGACATCGTACCGTTGAAAACATTCTCGACGGGAGGAGCTTTACCTCGAAGAAAATTATCGAATATTGGCGACTGGTCAAAAATGTTG
ATTTCATTAAAAAAAAAACAGGACTTCCGAAATGACAATGCCAAATTCACAGCTCCGAATCAGCCCAAGCTTCAAGCACAACCGTTTCTTTTATCTTTTC
CGGTATACTGGCCAGCAAAATATGCTGGGCAGTTTTTTTCATTCGATTTGCATGCAATAAATGGATCCAAGCATACTAACGAATCCCCGCTTGGCATTAT
CATTTAGCAGTCGCTGTACGTCACTATCGGTTGGTGAACACAAACATTCTGATCCAAACAGATGCATTATTGCTTCACGAAACCGTTTTTGAGACTCCAA
AATGCTCGGTCGAGATATTTCCAGGTTTTCGTAAGCAGAGTCGGCCGAGGATGCGTATGCAAGTACACGCAATGCCGCTGTAACTTTAAGTAGAGCTATA
ATACCCAATTTATCCGTTGCATCTGGCTTTGCAACAAAGAAATCGTCGTGGCTAACGACAGCATCGTGGATCCGAGTAAATAGCTCTTTGCGCATGCAAA
AGCGACAACGGAAATCTTCATCATTGTAAAGAGGGTACATCTGTAAAGTATTGTTCCTTTAAACGTGTTGCGCGTCCGTGAGGGTCTCGTCGTTTGTTTG
CTGCACGGCCTAAGCGAGAGCCACCAGGCTTTGGCCTGTTAAATGAGGGGAGTTTAGTCTGCAAGCAGGTATGAAACACTGCGCATTCCTCTTTATCGTC
ATCTAAGAGGTCTAACACCCACTTCGCGCGTTCCTGCTGAGCAGCATCCATCTCGACGGAAGCACTTCAGCTCTTAAGATACATCAGAAAATATAGGATC
ACCGTTGCAGATTCATGGTTTCAATGGTTTCTAATTACCAGCCATCGGAGCAAGCTGTGCTATTAACTGAAAAGAATTTAAAACCACCGTTGGCGGCGCT
AGTAACACAACCGTATGTAATAAAATGGCTTGTTCTAATTGGCGAATTTACAGCTGACCCTAGGAGTAAACGACGCTTACGACTTCGACGATACGGTACT
GTCAGCGGGAATGAATATTCAAAACATTTTATTGGGAAAAAGTACCCAAATTTAGAAATAGGGCTATGTGATGTACCCAAATGCATTTTGTGTTTTAAAC
GTAGTTGTCAGACTGGACTTTAATTGAGCCACAATATCAGCACAGCTATTATACATATTTTACACGTCCGAGATGACAGTGATGATTACAGAGCTGTTCT
CAGCATAAGTGCCCCTCCTCG