Description :
From Genome Similarity Track
Location :
Scaffold_75:448- 2545
Transcript NameFunction/comments
Phyca_LT1534128394PREDICTED: uncharacterized protein LOC100908025
Phyca_LT153420872OSJNBa0079F16.4

Sequence
2097 bases(100 bases per row)
tcaccacgcctccaccattctgacgcttcaccacgccttcttttccgtcatgacgcttcaccacgtcttcgacgtcctcaacaccaagcagtcctcggag
cttctcgaaccgctggggtccgagtgccttagtgaacatgtcagccatattctcctccgtaggaacatactcgatgtcgagcttccctctctcaaccagt
tccgctagcttccgacttttcttcgcatacctcttcacaccgtcgaagttcccggcgtccgtgcacaccttgatggtgctttgattgtccacgtagagct
tggcagtcctcttctcaaagccgagctccttgagcaactttctagcccacagtacgtcctctgcgcacaaactcgctgccaccagctccgacttgcacgt
gtcgtcggtcaccgacgcttgcatcttgctcttgaacccgacggcgtgtccgttcaacctcaacacgtaccctgacaccgaccttgacgtgtcgggacag
ttcgcatgatccgcatcgctaaatgcgctgatctgcaatccgtcgttctccgagcttctgcacttgtacaccaacccaaatgtccttgtccctcgtaagt
agcgcagcactctcttcgctgttgtgtagttctccttcgtatagttgctcgcatacctacttaggctccgcaccgcgtttgcaatgtccgggcgagtgca
tgtgaccaggtattgtagtgccccgatcagttcttgatacttgatcttcttgtcgttcaccttggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntccttcacagtcttgatgtcctc
accacagccgataatcatcacgtcgtccacgtagaccgtcagcatcacgagtctgccctcgatccacttgtagtacaggtccacgtcgtaattgcttctc
ttgaatcccatcttcttcaaatgtccatgcaaagtcagatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttcaatccatacagccctttcagcaacatgcacaccctgtccgtatcatcgtcgaacat
ctcgggttgttcaatgtagatagtcgctccgtccatctcggaattcaaaaatgcagtgtcgaagtccacctgatccacttccattgagagtaacagagcc
accaccaacacaattaacatcgtcacccaccgaaccactggcgagtatgtcttccagaactctttgccaaatcgctgcttgaatccatgcaccacgagcc
ttgctttataccgctgtacgtttccgtgctcgtcccgcttcactcgcagaacccacttcgtcgtcagcactctcgtgtctcttggcctcttcaccaactt
ccatgtcatgttctctttcagcgatgcaaattctttgcgtatggcctcttcccaatgcttcctctgcggcgacttcattgcctcatccagattttccgga
tcattgacgttgtcgttcatcatgagctgatagccgctcagcctcacgttcgtcgaccttaccctctgcgatcttctcacaggttgcactgggttgttcc
gtcgcccgcgtcgtctccttctattcacttgtacttgtacaggcgcaggaacttctggttgaccatgtacaggagcttgagcttgaccttgtacaggagc
ttgagcttgggccgctggtgcatctccgtcttcctcactctcggagtcgctgcttgacgagtcgtctgtctcctgcgtgccgtttccgaccgctgtttcc
ctgtgactcgaagttacttcggtccgtaatccgacgcctcgttcagcagcatcatgcacagcttcttttgccacaaattccaccgggagcggcacgt