Description :
From Genome Similarity Track
Location :
Scaffold_1974:448- 1938
Sequence
1490 bases(100 bases per row)
CCGAGCAGCCTCTAAGTTGTCGACGAACAGCTGTTGTTTCTGAACAAGGGCCCGTCCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGA
GCGACGAGAACCTCCAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCA
CCGAACCCCCACGCACACGCTGGGCATCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTC
CTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTTCTTCTCCTCGCGGAGTGGAGACTTAGAGGCG
GTACGCTTCTTTGAGGGCTTGGCGCCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCA
TCGCCACCGGCTTTGGGGGCGCCCTTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTAAGACTGTGATCACCGTGATCACTAGCGGGCGAC
AGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGACTGCTCTCGGACTCGGCATCGTCTTCAC
TGCCCGAGCTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGTGGCGCCTGCTTGCGCGCTTGTCCACAGC
CGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTA
CCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTG
CTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGCCCAAGTCGATGGTTTCCGACTTTGAGAATGAGAGTTTGTGACGAACACTCTC
TTCATTCTGATTGGTCGGAAACCCGAACCTAAGGGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGCATACATGGAGGTGTGACACTTCA
CACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAG
GTAACTGATAGTTTGTATTAACCACAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCTCTCTCTTTAATTAAAG
AGGGGACCTGTGAACTGGCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGGTGTGTGACCCCGTCACA