Description :
From Genome Similarity Track
Location :
Scaffold_75:44797- 45858
Transcript NameFunction/comments
Phyag_g1643hypothetical protein

Sequence
1061 bases(100 bases per row)
TCTGGCAAATGATACGAGACCTCCTCTCTCGTCGGTGTCAGCGAGTCCACGTAGACTTCGGAGATTAAAATTTTCAGGTTGATCCACGAAAGAATTCTCC
GTTACAACCTTGATTTGGTCGGACTCGGTCGCTGTCGAGAAGGCAGCATTACCGGTAAGAAGGGCGGCAATTGTCACCAGCAAGGGGTAGTAGGTCTTCA
TGGCTGAGTGACCGACTGTCAAGTATCGGGGAGCTTGGTAATTTGAACAGTGAGGAGTTTGTGGCGTTGGAGCAGCAAAGAAACAACTGTGGTGATTGTT
TACAGATGTTAATAGGTCTCGTACTGGGTTTTGTACAAACACAACAGCTCGCACATCCGTTCCTTCAATCTCATGTAGCTTCcctgtacatgtacaattT
GTCTACCTCCGATAAGAGTACATCTATTAACGTATTTATTGTTGTACTCTATGCATTTAACCATTAATTAATATCAGATTTGCCTTCCATATTACATAAT
CTTGTAAGAATAGAGGAGAGATCACAGTGGGGGCGAActtgaagctggtggtgggttCGAGTTCGAAAACAATGGTTGTTGCCGATTTCACCTATCCAGG
GCAGACTAACCAAGGCTTACGGTAAGTATTCGCTTGAGAAGGTGAgacacttccagcagcgctcgAGTCAGCAACTACATAGTTCGTACCGCAATCATTG
TGCATTTTACAGCGTTCGTTTTCGCGCTTCGGCACTTAGTAGTACACAGTGATATGAAATGTGAATGGCAAACTGGGTGAGTACAACTTCTTTCCAATGA
TGATACATTACGTCGCCCAGGGCATTCACAGCGTTTAAATAATCCAACAAAACAACGCTGGCCCACGCAACAAGACCCTGACATCTGACTATCAAGAACT
TGTTCGTCGCAAAATACAACGCGAACCTCCTTCATCGTATACCGGAAGAAGATATCACCTACTTGTCCCGCTATTTCGTCGGGGCTTCCgtcaaccgcac
aagcgtgcgtgccgtgttttggggactgttgtaaacagtGCCCCATTACAGCGTGCCTTTC