Description :
From Genome Similarity Track
Location :
Scaffold_121:44797- 45811
Sequence
1014 bases(100 bases per row)
CGTTACAATCAAGCTGTGCATGATATTTTCAAAGGAACACTGAAAATCAGCGTTCCATACCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACA
GTTATCTTGGCGTAATTGCGTGAATATTTATGCAATTACGCCGCTAGGCCAAGGAACTTCCGAAGTCCCTTGACATCTGTAGGCACTGACCAATCGGTGA
TCGCCTTGATCTTTTCCGGATCAGGGCGTACGCCGTGTTTACCCACGATGCACTCAAGAAGTAGTATTTCACTAGCAGCGAATATACACTTCTTGAGGTT
GGCATACAGCTTATGCTTGCGCATCATTGTAAGAACTTTCCGGACGTGGAGTCGGTGCACTTCCACATCCGTCTGTCCATCCATAGCCCGGCTATGGACG
AACACATCATCGAAGTAACTGGGCGCGAAACCTCTTACGGATCTTAACAGATTCGTTACACATCTGTTGAATATGGCAGGGGCTTTGCTAAGCCCTTGTG
GCATTACTAACCACTCCCAGAGAACACCGCTCGGGGTGCTTACTGCCGTGTACGGGATGTCTCGTTCACACATTAGGATCTGATAGAACCCATCCATGAG
ATCCATGGATGAAAAGATGGTACTCTTAGCCATACTATCTGTAATGACATCCTTCCTTGGTATCGGCGTCTGAGCCGGTACCGTTGCAGCATTTAACTTG
TTGAATGCGTGCACTATCCGCCATCCTCCAGTAGCCTTGCGCACATAGAAGGCTGGAGAGCTGTGAGGGGAAGTTGACTCATTCACATGACCCGCAGCTA
AGCGATTGGCAAAGAACTTGTCGATCTCAAGTACTTGTTCACGAGGCAGTTGCCACTGCTTCATGACACAGTACTTCGAACCCGGTTTGAGCTCGATTTC
ATGTCGAGTGCCTTAATCCTTAGAAAATTCGCATGGTACGGATTCAGGGAACACGTCCTTGAATTCTATCATATCCTTATATAAAGGATTTGCCTGAAGC
GAATCCCAAGATTG