Description :
From Genome Similarity Track
Location :
Scaffold_12:447912- 449867
Transcript NameFunction/comments
Physo_530100unknown
Physo_530117Hypothetical protein

Sequence
1955 bases(100 bases per row)
CTTGATCATCCAGGAAGCGTACATCGGACCTTTGAATAGCATATTCTTTTACCCTCGTGCCGTCAGCTAGACACTCGGAGCGGCGCAAAAGAAAGAAGAA
GCCCAGCACCGAAGCCCCCCAGATGACTCGGTGCTGGGCACAGGAAAAATCGAAGGAGCTGTGCAATTTTCCGAGGAGATGCATGGTGACGGGGCCTTGG
GGTTGGTTGGAGGGTCTTCTCTGCGCATGCCGACGACAGCAAGCTGGTGTCCGGGGGACAGTCCGACTTTGTATCTGACGAAGCGCTTGTGATACCACGA
GATGTGGCAGAGTTTGGAGGGCACGGTGGAGGTAGAGTTGCCTCTTTCGGACGAGTTCCATCCGAATTTCCAGCAGTAGATTGCGAAAAGTGGGTAACCA
TTTAGGCAGTCGCATTTCCGTGGACCATCGCACCCACTGTGACCAAGTAGCTGAGTATTTAACGTTTGATGACGAGGCCAGTGAGCGGGATTGAAGTCCT
TCGAGAAGTTCGTGTAGAGTTTGCGAAAGATTGGCGGCACGGCTGTCTGTTCCCAGGACACAGAAAAATTAGTCCACACAGTTTTATAAGGATCCGTCCA
GGCCCTCGATGCTGCGTCTGCCATGGTATTGGTCGACCCTGGTAAATGCTCCACCGATACTCGTAAGTTGAAGTAGGCTCCGGCTAGACGAATTGCCCTG
TTGATTTCTTGGCTGAGTTCATTCTTTGAAGAAAGTCGATTGCTCCACTGCACTGCTGAAATATTGTCACTCCAGCACTTCACGTGAAGCATTTGGCCGG
ACGAATTGCTCGACCACGACGAACCCCAGGTCCACAGTGCCAATGCGATGCACAGATGCTCCCGCACATTAATGGAGAAGCTGTTGAAATGCGTGTCATC
GTTGGCGATTAGAAGAGTCTCGGTCTCGTCAAATTTTTCTTGGATAAATTTATTTGCGCCAGGGTCCAGAATCGCCAAACCCATGTTTGAAGCATCCATG
TACAGTTCCACATCGGATGAAGGAAGATCACCGAACATGCTCAGGGGTAGCGCAGCGAAATTCCCATGACTCAGGATGTTTTGAAACCATCGTAGATCCG
CCTTCGCCCCGGCGGAGAGTTTTACTTTTGCAAACCGTGGTGCGGCGACTGCAAGTGCTTGCAGCTGTTGGTAAAATGGCTTGGCGGCCCGCAGGCAAGT
TGACACATGTCTTAGCGACCCTAGGAGTTTTTGTAGATCCGATTTTGTAGCTGCTTGATGCTGAATCATCGTATTTACTCGTTGTAGCGCCTTAGCGATT
TGTCAGCTGGCATCGATACTGTTCGCTTTTCCGTGTTCCAGAGCAGACCTAGGGCGACGAGTTCGGTGCTCCAGTTCGAGAACTTGGCCCCATTAATTGA
TCGGGGTCCCAGCACGGCTAACATCGCATGCCGTAGGGTTGCTTCTGCGAGATGTAGCCGATCATTGACGTCCAGCTCGACTAAAATATGATCATCTACC
CATTCGTAGCCAAAAAAGGGTTCGGTATCTTCGGAATCAGCGACGGTGGCAGGTGAATTAGTTGTCATCAACCACGAGATGGCACGTCCAAACAGCCCAT
AAAATGGTGGGGATCCGGACCATCCGAAGGGGGCTGCTAAGTCGATCAGTAAAATCTTGAGGTCTGTCACCAGAGCTGCCATACGAAATACTTGAGATGC
TATTGACATTAGATGTCGGTATGCACCTTTCACATCGCCTTTCAGGATACATACGCGGACACCAGGATGACGCGTAGCCAAGTGTTCGATACGTCGAGCA
ATATTAGTCACTGGCTCGTAAGTGAGGGCTGGCACCGACTTTTTCTGGTAGTAATCGTTCGTAGAATTACCAAATGGGTACGATAGGTCGTGAATGGTTC
TCACTTCAACGGAGGGATCCACGTCCTTCTTCTCAACCGCTCCTAGTGGGCTGCA