Description :
From Genome Similarity Track
Location :
scaffold_402:4479- 6281
Transcript NameFunction/comments
Pl_105186copper-transporting ATPase, putative

Sequence
1802 bases(100 bases per row)
TTTTTCGAGTCGTCGGCGATGCTGCTGACGTTTGTGACTTTGGGTAAGTACATGGAGTCGATGGCGAAAGGAAAGACGGCTGATGCACTGTCGGAGCTGG
CAAAGTTGCAGCCGAAGACAGCTTTGTTGATTAGCGAGGGTAAACGCGATCGTGAGATTCCAATTGAGTTAGTACAGCGTGGTGATCTGTTACGCATCCG
ACCTGGTGCAAATATCCCAACGGATGGCGTGGTGAAGTCAGGCTCGAGTTCGACTGATGAGTCGATGCTGACGGGTGAGAGTATGCCGGTGGCAAAGAAG
GAGGGTGACTACGTCTTTGGTTCAACAGTGAACCAGCAGGGCACATTGGTGATTGAGTCGAGCTGCATGGGTGGTGATAGTTCGGCTTTGTCCCAGATCT
GCGCTTTGATTGAAGACGCTCAATTGCATAAGGCTCCGATCCAAGCATATGCAGACTGGTTGGCGTCAATTTTCGCTCCATGCGTTTTGGGTATGGCAGT
AATGACTTTTATCGTGTGGATTACGCTCCTTTCACTCGACCTCATTCCATCTGAGTGGAAGGTGGAGCTTGGTGTAGATGCACTGGCTGATCATTCGGAT
GATATGTACTTGGCGGTCCTGTTTGCTATCTCAGTGGTGGTGATTGCATGCCCATGCGCTCTCGGACTTGCTACACCTACGGCTGTCATGGTCGGCTGTG
GCGTCGGCGCCAAGAAAGGTGTGCTCATCAAGGGAGGTCGTGCTCTTGAGACAGCACGTTACATCGACACTATCGTATTTGACAAGACTGGTACGTTAAC
TGTTGGTCACCCGTCGGTCCGTGACGTAGTGATAGCAGACCGCGCGTATACACCGCGCGAACTGCTATACTATGGTGCATCGCTGGAGTGCGTGAGTGAA
CACGTTCTTGGCAAGGCTATCGTGGTGACGGCAACGGAGCACGAAAAACTGGAACTCCAGGACCCAACGAAAGTACGTGTTGTACCCGGACGTGGTATTG
AAGGTGTGGTGGCTGCTAGCAGTGTGACGTCTCGGAATACTCCGGTCACCGTACTGGTCGGTAATACGGAGTACTGCGAGGAGAAAGGCATTCAAATCAG
CGAAAAGATGCGTGCTCAAATGCACGAGCTGGAGCTGGAGGGCAAGACTGTGGTGGTCGTGTGTGTGGAGAACAAGCTGGTTGGTGTCATTGCGTTGGCA
GATGCAGCAAGACCTGAAGCAGCTGCTGTCGTGAAGCACCTAAAGTCCATGGGACTGGATGTATGGCTGATTACAGGTGACAACCTCCGCACGGCCAGTG
CAATTGCACGCCAGATGGGCATTGACCACGTCAAGGCAGTAGCTTTACCTGGTGAGAAGGCTTCTCAGATAAAGGCTCTGCAGTCACAGGTGAATCCGTT
GACGTTGAAGCCGCGCGTTGTGTGCATGGTTGGTGATGGCATCAACGACGCACCGGCATTAGCTCAGTCGGACATTGGTATGGCTATCGGCGCTGGTACA
CAGATCGCCAAGGCTGAGGCCGACATGGTGCTGGTGAAGAGTGCGCTGACGGATGTGGTAGTGGCGCTGGACCTGGCCCGTGTGGTGTTCTCTCGCATCA
AGTTGAACTTCTTCTTCTCAATCATTTACAACGTCGTGGGCATTCCACTGGCGGCTGGCATGTTTTTCCCGTTGATCCATCAGATGATGCCACCTGCATG
CGCCGGGTTGGCAATGGCATTTTCTTCAGTATCGGTGGTAATATCGTCGCTTTTGCTCAAGAGTTACCAGCCACCAGCAGTCGGTGAATCGAATTTGAAG
CA