Description :
From Genome Similarity Track
Location :
Scaffold_126:4479- 5681
Sequence
1202 bases(100 bases per row)
CGGAACGCGAGGGTGGGTGGGACCGTTTACGTTGAACGGAGTATAGCCTGTAGAGGCATGAACAGCGGTATGCAACGCAAACTCAAGAACAGGGAGCATG
GAGCTCCAACGCATAGGCGTATCAGCGCAAACACTGCGCAAAATATCATTAATGACGCGATTAACACGCTCAGTTTGACCATCGGTATGCGGATGATCCT
CTATGGACACGTCCAAACGGGTGCCGAGCACCTTGAATATGGACTTCCGAAACTTCCCAGTGAAGCGGGGATCTCTATCAGAGACAATTGCCACTGGCAA
ACCATGTTGTCGAAACACACGGTCGATAAACAGCTTCGCTGTACCTTCGGTATCAATAGAGTCCAGCACTGCCGCTAGATGAGCCATCTTGCTCAATCGG
TCAACAAAGACCACAATGCCAGTGTCGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATACTCATGGAATCCAAAGCATTAGTGGGTACATGCA
GACTAGCCAGCGGTGCCGCCACATGTGCTAAGGGTTTCACCCGTTGACACTTTTCACACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTGGGCCA
CCAATAAGCCTGGCTCACTGATCTATAGGTCTTCTCACGACCAAGATGACCACTTAAAGCGGTATCATGTGCCTCATAGAAGATTCGATACATCAACTCC
TCATCATGAAGGACAGCGATACGAGGGTTATCCTCAATATCTGTGCGATAGCACAACAGGCCTTTATCGATAGAATATCGATGTAGCCTCGCACGTAAAC
GTGCCGACAATTCTATGTCCGAGTCTTTAAACTCCTCGCTCCCAAGAGAACGTAGCAAAGCTACACATTGTTCATCCTTGGCATAAGCCGCACGGATTAA
GTCAGTGACTGACGGTGACAGCGTAGTAGCGTGAACAAGATCATAGTCATGTCGGCGCGATAGCACATCAGCCTGGCTTGTACTTCACTTCGAAGTTATA
TTCGGCAAAGAATGAAAACCAGCGAGCCATTCTCTGAGAGAGATGCGGCGACTGTGTCGCAGTGATGCATGATCTGCATAGATCACAAATGGCTTTGAGC
CAAGCAGATGTACTCTGAATTTGACTAGAAAGTACCTCATAGCAAGTAGCTCCTTGTCATGAACGGGATAGTTCTTTTCAGCAGCTTTGCACTGACGAAA
TT