Description :
From Genome Similarity Track
Location :
contig_10:44782- 47030
Transcript NameFunction/comments
g3420.t1hypothetical protein

Sequence
2248 bases(100 bases per row)
GTGTACCGCGTTGTTGAGTGCAAACTCAACCATCGGCAAACTGGCCGACCATGTGCCGGGAGATTCGGCACAGACATGTCTTCGAGGACGCGATTGACGC
GCTCCGTCTGGCCGTCCGTTTGCGGGTGGTCGGCCGTGGACATGAGCTGACGCGTTCCAAGCAATTCGAACAGCGTTTTCCAAAACGCAGACGTGAACCG
TGGGTCACGGTCAGAGACAATAGTCTCAGGGAGGCCATGATAGCGGAAGACGCCATCCAGGAACAGCCGTGCAGTCTGTTCACCGGTGACTGAGTCAGCC
ACCGGAGCAAGGTGTACCATCTTGCTCAAGCGGCAGACAAACACCAGGACGCCGGTGTTGCCCTGGGCATCAGCCGGCAGTCCGAAGACGAAGTCAAGAC
TCATCGACTTCCAGCAGTCTTCCGGGACTGGCAGGCTCTGCAAAGGAGCCGAGGCATGACCAGCAGGTTTCACTCGCTGGCATGTCTCGCAGGTCCTTAC
ATACGTGGCGACCCACTTGTACATGTGGGCCCACCAGAAGACCTGGGAGACTGACAAGAAGGTCTTTTCGCGGCCAAGGTGGCCGCTGGAAGGCACATCA
TGCGCCTCCTGAAGTATGTCATACTTCAGATCCTCGTCGTTGGGGACGACTATCCGCGGAGGATCGGCCGGATCCACGCGGTAGTGGAGGAGGCCATCGA
CCCACGCATAGCGATGGAGGCGGGCACGATGGCGGGGCGTTAGCCATGCATGCTTGGCCTCCTTGCCAGCGGTGAGGAACCGCACGATGGGGAGAGATTC
TCATCATCTCGATACGCTAGCCGTATCCGATCGTACAGATCTGTCGTAACCCGACTAATGTGCGCGAGCTCATAGTCGGGTCGACGGGATAACGCGTCGG
CAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATTCCGCGAAGAATGACAGCCAGCGGGCCATCCTCTGAGACAGATGCGGAGAGTT
GGTGGCCGTCCGCAAGGACGCGTGGTCTGTATAGATCACAAAGGGCTCAGAGCCCAGGAGGTGTACCCGGAACTTGACAAGGGCATACTTCATTGCGAGG
AGCTCCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGCCTGGACTGGAACGAGATGACTCGCTCGTGCCTCCGCGTCGTGTTGCAGCAGC
GCGCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACGGTTTTGTCTCGTCCGGCAAAGCCAGGACCGGCGCGCGCTGCAAGCTCGCCTTGA
TGCTGTTGAATGCATCCTGATGACGGCTCTCCCAGCGCCAGTCGGCATCCTTCTTAAGGAGATCCGACAGGGGTCGTGCCAGCCCGGCATACCCCGCACT
ATACTTGTGCAAGTAGTTGGCGAGACCCAACCACTTGCGAAGATCCTTTTGGGATCGTGGTGTGGGCCAGGCCGCAATGGCCTTGACCTTCTCAGGGTCG
GCTCGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCTCTTGTGCCGCAAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTTGCTCTCA
TGACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGCCGTCTTGCCTTCCCCGGCACGGCTATGGACGAAGATATCGTCAAAGTACGTCTG
CGTGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGGGCATTTGATAGGCCCTGTGGCATCACTAGCCACTCCCAGAGC
ATGCCGCTCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGC
AGCCCGCCATGTTGTTCAACAACACATCCTTGCGGGGAATGGGTGTCTGGGCGGGCACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCA
CTTCCCGTTCGGCTTGCGAACGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCA
ATGACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCACGAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTG
GGAGTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCA