Description :
From Genome Similarity Track
Location :
Scaffold_134:44781- 47761
Transcript NameFunction/comments
Phyke_g4784U3 small nucleolar RNA-associated protein, putative
Phyke_g4785conserved hypothetical protein
Phyke_g4786ATP-binding Cassette (ABC) Superfamily

Sequence
2980 bases(100 bases per row)
tcatccacaaaCACCGTGTGCTTATTGTTTTTAGGGGTGTCAATGAAGTGTAACCCTCGGTTAAGTTTCTCCGCTTTACGGAGGTCAACGGCTCGTTTCA
TGTGCAGGTACGCTAAGTCCTGGGTCTTGAGGGTACGCAGCGCCTCAGCGTTCAGTTGCTTGGCGTGGTTATGCGTGGATATGTGTACTCCACCCTCCGT
CTTACCGTGGATCATCTTGTAGTAGAACTCATCGGGGTTACGCATGGATGCCTTGAGCTGCAGGTTCCGCAGGTGTTTCTGCTTCTGGTTGTAGTCCTTG
GCGCGCTTGACATAGTCCTTGTGCTTCTCTAGCAGACCAAGCTTCCGACGCTCGCGCAGTTGTCCACGCTCCTTGTGCTCACGACGCTTCACCACGTTAC
GCAGAGACGACATGCTGACCAATTGACCGTCTTTGATAGTGGTGGATGACTGGCAGCGAAAACAAGAGTACAGTGAGTCATAAAAGTCTGCATCCGAACT
AATTATCTTTGTTTTATTAAGGAAGAATAGCGTCTTCTTTTGGTAAATACAGTACTCTCTTGCGTTAAACTTTGGGTACTTGGTACCCAAAGTTTGGGTT
CAGTCGTCCCAAAATGGCAATTGAAGTGTACTAATTTAGGACTAATTTAGGACTATAGTCTCAGAAGAGTCGCAATAATGAGCGACGCTAATGATGCTGG
ATTGATGGAGCTGGGCGACGGAGAGATCGATTGGAGCGTCGTATCAGACTTCTTGGAGAATATTGAGGACGTCCCGGACCAAGTGTCTAACCTCACAAGT
TCTACAGTGACTGGACCTAATGAGCCGATTGCAGTTCCGAATCGACGCTCAAGTCGCCGTCGCGCTTTAGTAGCGAGCAGTGCCCGGCGCCAACGAGCCC
GTCAAAAGGTTGGTAGAGCATTGAAGCGATTGATACGGATTTCATCAATTCCTTATCCAACATACCAATTGTGTTGCGTATTTACTGCAGAATGAGAGAC
TGGAGCTTCGTAACCAAGTGACGAAACTCACTACCGACCTCGAGTTACTACGCTCAAAGCACAAACAGTTACGAGGTGATGGTGTTGCAGCATGGGAAGA
GAGAGCTGTGGCTCAGCGACGGAAGCGACAACAATCGGAGGAGCTGAATGGGACTCTGAAGCAGGCTTTAGTGGCTCAAAGAGGCTTCCTCCGTGGCCTG
GCGAGAGTTGCGTCCACTGCATCCAGCTACTGCACGGTAGGCTTTGGGTCGGTTTGCTTTATTGGATATGCATACTGCACTAGTATACTTGACTAATTAT
TGACTCACCGAGTCACTTGTGCAGGAGATCAATCTTCGAGCAATGCTTCATACGTATACGCGTGTCAGGAAGGATCCATGTTCTCGGTTGCTCAACTTTC
AGGGGCTACTCACCGACCGCAAGCTTGATTTGGCCTCCCAGATTGTGATACAGGAGACTGAGGGCATTTCGTTTACCAGTCCGATCATTTCCACACAGCG
TGTTCGGACACAAGCAGATGAATTTGCTGCGACAACGACTGCAGTATACTCGGTCGACACGCTTAACGTAAGCAAGACTTTTGCAGCGGCACGCAACGCG
ATTTTGAACTACCAACCTGACTGGCCAAAGTATCAATTACTAAAGTCTCATTCGGAAGTTGTTGAGTCCCCAGCCACGCACGTCCACTACAATGTGTCTG
GTGTACATTAcagaagctcaagtggaGAGATTTCAGTTGAAGGCCGCGCCATTTCATACTATCGATGCAATGACAAATATGCTGTTCTCGTGTGGGATTT
CATTGACGTCGATGAGCTGTACCCACTGCAGAACGGAACTGATGCGAAGCGAGACATCATTGGAGCGTAAGTTTTTTCGTGTATCACTGGTTCAAGTTGG
GGAACTTAGTTGGTGTATACGTTTTTGCATGCAATTTCAATTCCGCAGCGCTGTCGTTCGCCGAGAATTGTGCGCTGACGGTCATGAACGAGTGGTGTGC
AGGAGCATTTGCATGAAGATTTTGCGGCTTCTCTCACTCAATCCTGTCGTCTCGCAAGGCATTATCGGCGTCCCACAGGAGACGATACTGGCCATGAAGG
CTTGCACGTACCGAGTCTACaatgcagtggtggaggcCAATTAACCCAGCAAATGGTGACCTCGACTCATGAACCAGCACGCGCAATTTATATCAGTTGG
CCTGAGAGCGAAGGTGATTTTGTATTGTTTCATGTTGCTCAAAGTAGACGTGTTTAACAAGGCATTATATAGCCATGATTTCGCACCTACATAACAGTTA
GTAACGCCTTCCTACCTACCGCTTCTGATGGTTGAGGAAATGCAGGGCCAACAACGTCAGCACTCGGAACACTACTATGGAAATCAAGAGCGCCCCGAAG
TTGCTTGCCATGTCGTCATACTTCAAGTTGTAGACATCTTCGAGAAGCCCCTTTACTGTCACGTTCCCAACCGAGACTGGTGCGTCCTGCAGCGGCTGGC
ATCCAACTTCCGGGCCGATGTTAACGTATTCTCCAGTTGCAGTATCTAGCTCGGGGGTCGTAGAGCACTCACCATATACCAGTGCGCCAAGAATCGACAT
AGCGTACCGATGAGGCGTAATGATATACAGCCACTTGTAGCCGGCCAAGATGGCGTTGCCTGGGGGATTAAAGCCAACGAACAGGAAAATCACTGTGGTG
GCACCTGATCCCGTGAGCGATGCCATGACGATGTTCGGAAGCGCAAATGCCAGGAATTGTCCGATATAGACATCGACCATGATGGATAGCGATACCGCGA
gccaaaacaaaatgaaCTTGCCAAAGCCCGACACACCCATGCAAAGGAAGATAACGACGGAGATGATCAGTCCCTTTGTAAAGACGTACGGGATCTCGAC
AAGTGTTTCACCCACAAAATACCAAAAAGTAGCGTACGTTTGCGCGGACCGCTCGCGGTAAAAAGCTGCCCGGTCGTCGA