Description :
From Genome Similarity Track
Location :
Scaffold_42:447719- 451154
Sequence
3435 bases(100 bases per row)
CCACAACAACACCGATATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTACCCGTTACCGTCACAGGCGAGCAAGCCGCGAGG
TTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGGCGATTGTCTCGGCGCGGCTCACGGCTGCGTGTTGGAAAACGCTGTTTCCTTACTGGA
AACCCGTCTGCAGATGTCCACTGCGGACCATCCACAGACAGACGGCCAGACAGAGCGCGTTAATCGAGTGCTCGAGGTCACCCTGCGCAGAGCGTGCGCG
GAAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTCAATTTGCGCTGAACAACGCGGTGCACGCGTCCACGGGGTCCACGCCGCTTTACTTGAACG
GCTGCCGTCACCCCAGAGTGCCTCTCACTTTTCGAGAAGACACTGCATCCTTATTCTCAGTGAGAGAGAGGCTCGGAAAGCTCTTTCCTCCCAGGTCTCA
GATGTGAGACCGGTTTCGCTACGGAAGGAAGTGGAGTGTTTTTTTTATTCCAAGCTGAGCATTATCAGCAGGGCCCGCGGTGCCATGGCAGCGGCCCCGG
GCGGGCAAAAGGAGTACTCTAACAAACATGGAAGAGGAAACTTAAGTATATTTAAGGTGGGGGGCTTAGTGCTATTAGACACGAGGAACCTTCCGCTGCA
CACTGCCAGCTCTGATGGCACCAACAAGCTGAAGCACCGCTTCATTGGAACATTCGCAGTCCTGGCCAGGCATGGTACGTTGTACACCATCGACCTGCCT
AAGGCAATGACGACGCACCCGACGTTCTACGTTGGACGTCTTAACCGGCACTTTGAATCATCAGGGGGTTGCTGACTCGCAGACCCACCTTGGTCCACTC
CTCAAAGCGAGGGCCGGCCACAGACGTCACCGAGGGCGTCGGTGCAGGCACCCGAGCCTCGTAGCTGAACGGTCAAGACCGTACGCAGTAGTGGCCCCGT
ACGAACGGACCTCGGAGCCATACGCCGAGTACGTCAGGTACGCACCATACGCGTACGACTGGGAGTGCGCCGAATGCGGCTCCGGATGTGGCAGCAGAGC
ATCGATACATCGGATCATGCGGAAGGCCTCGTCGAGATCGAACGAAGAGGCCCGCCGGTCCACCCGCAGATGCAGGCTCCAGACCTCACGCTCCAACAGA
TCCAGGCGGTCCGCAATACGAGCAAGCACGCCCTGATTCCCGGACTGGGCGGCAGCATCACCGCCAGTCCCGAGACCAAGCCAACCTCAGGATCCTGCGT
CGGACCCGTAGGAGAAGCACTCGGACGAGAGTAGCGTTTGGGAGGCTCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGA
AGAAGTCCACTACCACGTGGAGCAGATTTTCCAGGAGCAACGACGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAAC
TCGTCGGAGCCGATTGAACGGCTCCTGATTGACTGCCCTAAGGCTGTCGCAATCTGGGAACAGAAGCGGCAGCAGCTTCATAAGTAGTCCGGGGCTTCTT
GCCCGAACGGGGTACGGACGTTGACGACACTCTGTACCCGCGCTCATCGTGAGCGTTAGAAGCCGCGCGCTTCAGAATGTCCCTTGGTGGCATGCGCTTG
CTGACCAAGTGGGAAAACCGGACACGAAGATCAATCTGGTTCAGGATGCGGGACAGTAGCTGATCTTCATGGAGTTCCCGTAACTCCGAGGGTGAAAACT
TGAGATACTCTATCCAAGCCCAGAGCATGTACTCAGATGAATTCCAGTTGAGACAGTTTTCGGGAAGAACCCAGGGATAGCCCCAGAGAGGGTAGAGACC
ACCCGGTTCTCGGGCTTCTTACGACAAGTTGTGAAGTCCTCAAGAGGGATAAGGTGTGGCGCGAGAAGCACACACCGAGCCGCCTCCAAGTTGTCGACAA
AAGACTGCTCCTTTTGAACAAGGGTACGGTCTTAACGCCCCTAGAGGTGTGGCCGCCAACAAGGCCACGAGGAGCGACGAGAATCGCCAGGAAGAGGTCA
GCCCCAGAGCTCTCCTCGGGAGGCCAATATCCTCGTGGGTTGATGGCAGCTCCCTGGCTGACGGGTGCTACCAACGGCCCCCCACGCGTACGCTGGGCAG
CTTGGAAGTCCTCCTGCTGCTGGTCGAGGTCGTTAGTGATCTCCCGGGGCTCAGGAATAGCACCCTCTTCCTCCTCTTCCTCGTCCTTTTCATCCGAGGG
CCCGAAGAGGCTCCGATGGGAGTACCAAGTCTCCTTCTCCTCGCGGAGTGGAGACTTCGAAGCCGTACGCTTCTTAGAGTGCGTGGCACCTTTGGCTTTA
GGGGCCTTAGCACGCGCAAGACTCTCGGCAAGCGAGAAACGTTTGCAAGGTTTCTCATCCTTCTCGTCGTCAGCTTTGGGAGTGCCCTTAGCCTTGACGG
CCGGGCTCTCAGAGCGCACTGACGTCCTGGGGCTGTGATCACCGTGATCACTAGCGAGCGACTGCACGCTGACGCCTTTGTGCTCGCTGGGCACTGGGCT
GTGCCCTCCCGTAGAGACCACAGGAGCATCGTGCGAGCTCCCGGTCTCGGCTTCGTCCTCACTGCCCGAGTCGAACTCACGTTCAGCGAACCTAGGGAAT
TGTCTGGGGAGGCCGAGGCGACGGACTGCGGCGCTTGCTCGCACGCTTGCCCACAGCCGCGTCACCAGTTGAGCCGATCGCCTCGGAGGCCACCTTAGTA
TCCTCCTGGAGTGCCGAGCCTTTGCCGTGAGGCCTTAGTACTCTTTGCGTGCGCCGTTCTGGTAGCAGCCCTGGACCGTGTCTTCGCACCGCTCTTCGCA
GTGCCACGGGGCATGGTAACGGTCGATGTGAAGACCAAGAAGAGGAGCGCTCAAACTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCCCGCTC
GCGCAGCAAAAACCGCTCTCTATCTTCCCTTACAAAATGCGAAGTCTGCCCACCTCCCCCCCTCCGCCTTACTGATCGTTATTTACACTCTACCTCCATC
TGGCGTGGCCCTCCTCGGGTCAGGTATTCTCCAAAGGTAACACCCTAATACATGAAGTATGACACTTCATACTTTCGGGATATTTGGGTACAAGGGTACA
ACGGTCCTCCAAAGCCACCCATTGGCCGATGACATTCGCTTTTCTTTAGGTTATATATTTAACTTAAGCTTGTCTACCTATAAATATACTCAGCTTACAA
CTTACCTTAAATTGGTCACTTCGCTCCCTTAGGTAAAAGGGACCTGGCAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGCCAACTTCCTCTAGC
GCAAGGTGCTGTGTGACCCCCTCACAATAACAACA