Description :
From Genome Similarity Track
Location :
Scaffold_1600:4476- 8433
Transcript NameFunction/comments
Phyta_totarag13333hypothetical protein

Sequence
3957 bases(100 bases per row)
GCATCCGTAAGCGttccaccatcaccacccAGCTGCGGATACCACTCCTTGGGCATGCGCGATTTCGGAAAATGGAGGAAGTAAGGGTCGAGAAGCACAT
CGACGAAGGTGCAGCGCGGTCACCACATACCCGAGATACTTCTTCCACGCCCCTGCGCGACTCCGTCACTGACGCCGATTTTCGTGGTAAGCTGCCAGAA
TAGGGTCGCCGGCCAACATGTTGTTGGAGATCGGCAGGAAATGGGTAGATTCCCATAATGCCCGCAAGTGACGAATCTCGAACTCGAGGTACTTCTCGCA
GTATCCGGGCGGCATGTGATCTGGCATGAATGTGAGCGGTATGAATTCAGTATCCACAACCCCCCGCGGCGGTGGCACAGACTTCATCAAATCTTCGACC
GCAGCAGGGGCTCATAGCTGGACGGAGGTGGGCGAGTCTCAGGATCAAGATCAGGGAACATCCACTCGGAGATGCTGACCAGCACTCGCTCAAGATCGGG
ACGTCGATGTCTGTAACGCGCAGATGACCTAGGGCATCCTGGTCCCAAGGTGCAACGTCCGACGCCTGATAGAGGCGCTGTATGTTACCATGAATTCATT
CCGACGGTCGTAATAGAGGGACGTAGACGAAAACCCTCCTCTTCTCCACCAGGCATCGCCATCGGGACTGCCAGTGGCGGCAGATCGACCTTCGCCAGAA
TGAATATTCGTTACAGAACTAGGGGACGAGTTGCCCGAGGAGCTGTCTTCGCTTGGACTGTCCACGGAGACCGGATCATCGGCTGATCCAGCATGATTGA
ACGACCCTGCGTCGGACAAGCTGGCACGACGACGCTCAGATCGAGAACGAGAGGGTGCCATCAACAGCTCAGGGTCGTTCTTGTCCAAACTGCTTTCATC
TTCGGAAatttcttcagctcgatcTTTCACTGTCGCACGATCTTCAGCCGACACGGAAGCGTCACCGGCATCTGCGATCTCGCCCGAAGTTTCGACCTCG
ACGTCACCGGATGCAAATTCGACGTCCTGCTCCAGATCCGCGGTTGAAAAGTTAGTCGGAGGTAACGTTCCTCGAGATCGCGACGGTGACTGTGATCCAA
CAGAAGCCGAAGACCGCGAGTGGGACGGGGACATGGGACGTGTTCTGAAGCGAACAGGTGTTCGCACTGGGGACGacgatcttgatcttgaacgTGTCAG
AGGCGGAGACTGCGAGCGAGTCAATGACAGGACCCGTGGTCGAGAACGAATAGAAGATCGGAAAGGAGATGTAGATCGTGACTTTGAACGAGCGACAAAT
GGAGATCGTAAATGTACAGGAGAAGAACCGGGTGACGCTGACGAAGTCCGGCGAACCTTTCGCGCACAATCTGAGATGGCTTCGCCATCTGAAATGCGCT
GACCGAGGGTGGTTGGCGAAGGTGCCGAAACTGGGTACCCCATGGCGGACGCAACGGCAGAGAATCGCGCGTGGACATCCACGTTATGACTGTGGAGACG
ATCATGGCCACGACGTAGGTCGTCGCGATCTTGACGGAGACCTTCAATCTcttgacgacgagaagcgagTACTTCCTGCGATATAGCATGTGCCCACGCC
ACCGTGCCACCTGCTGTTCCAAGCGAGAGATCGTTGATCTCATGGACGAGACATGGGCTACTTGCGACCGGAGATCGATGCAAGCTTTCTCCAAGCGGCC
AGTCTCTGCATCAAGGCGggcgacagcttcagcatgGGCGACGCGGGCCCCTCGCTCTGGGTCTGGAAACTGCCCCGCTCTTTACCCAGGCGGGTGACTC
TttgatcttgagctccaccTGGCGACGAAGTTGAGTCACAGCGTCTTCTAATGACTTTACCGACTGCAGTAGTGCCTCACATCGCTGCCGTGCGGCATCA
TGATCTCGGAGAGCATCGGACAACGCTTGATTTTGAGCTTGTAGACGACGCTCGAgaccaggaggaggaggcgaatCAAGATCGGGATGAGTCGTCACGG
CAGAGGTCTGGGCCTGTAAGTTCGCGGTCAGAGCTTCGAAATCAGCTATACGTcgctgaagatggcgaatggtgtaacggggttacacgtacaagtggct
acatcacttgtaacctaacaaaagtggcttctgttagaagttagttacttccttccttggtgtgaggcacaccaatggctacatttagacggacgactgg
tccgagatctcattggtagaaagaagcatctttctacccaattagaatcataggattctgccgactacccgtcggcaaacccctattacatagtatgacN
tcaatttcacctaaagtgttaattattatctttaataTAGcttaattatacttgcaggacgcaagtataataaatccaagtcgaagaaacctacgcttcc
tcatacacgtgcgcacaagtgtaagcttaagtattgggctaagtaggcccattacaaaTGGTCGTCGCAGAAGCCACTTGAGACTTGACATGTGCCTTGT
TGGAGGCGAGATCCGAGTCAaccgccttctccagctgctccacgaccGAGTTGCGTTCCTTAAGTTGGGAACGCGCCGTTTGGAGCGCGCCGAACAGGGA
GTTATGTCGATTTTGACAATAGCGGACGAACGGGACAGCGGCAGCCGTGATGGACGCAATCTGGAGGTGAAGATCGCCAGCATGGTGAATAGACGAAATG
CGCGCCCGTTGAAGATCGACGTGTTCTTCCTGTAGTTGCCAAAACTCGGGCTTTCGACGCACAGCGATCTCGATCCCCGGTAAGGCTGCCAGAACACCCT
GAAGCGAGCCAAAAACAGCAGAAAGATTGACAGGAGATCGATCGAGGTGTATTGTTGGGGACGACGCATGACGAGCGCATTCAAGACATGGTGGCGTGTC
ATCGGCAGGACGATCTTCAGCGGTAGCAGCGTCAGCAGTAGCAGGATACTTCTCGGCGGCTGCAGAAGCGGCGGCCATCAACAAACGGAAGGCGGAGGTG
GCCCAGTGGCCGAAGCAGGATCACCACGCGCAGGATCGAGGTCAATGGCGGAGCTGGATCAAGGTCGATCGTAGACGCCGACGTTGCAGGAGACGCATAc
gcagatggagaagacACGTGCGCAGTGGGAGACGACgcggccgcagcagcagccgaagaCGCAGTTGCAGTAGCCGAGGATGGGGACGCGTagacgcagt
cgcagcagccggTGATGCAGGCACAGCTTGGGGCGCAGACGCAACAAAAGACGCGCGATCTCGGCGAGGATGCCGAGCGcccgaagctgcaggcgacaTG
GCACGAGGCGACAGGGCGTGGCGGTGAGCTGGCAAGTTGGAGAGTCTTGAACAAGGTGCAGCGAGTGAATACCGTTGCGCGGCTGTCACTCATACAGGGG
ACGGCTGTGGGGAAGTGGAAGCggaaatttcctggtcgatctgggcccatcaatcaagatcgaccaaggtacgaagtCATATAAGCGGAACACCCACAAG
TATGACGACCCCAAGATTGGTGGCTAcacaagattgatggctacaacCCAAGactgatggctacattatCAGCACTTCTGATGAGAATCAGACGGATCAG
ATGATATCGACCTTGACAGGGATTAAGCCAGTATGAAGTAAGGAGCCTCGATCCAAGTCCCACTGATGGCGCAAACAGTCAGGGAGCGCCAGTGAAGTCA
AGGGAGCATAGGGAGATCTAGATAATTGTATGGGAACCATAGAATAGGTTTAGGACATGCTAACATATAATTCAGAGccaaatttgccttctacagcACA
AGCCCCGGACTGCCTGGATTATCTGCTGGCCAGGTAGCCCGTCGACCCTCACATCAAGACCGCGCTAAAGGAAGCGGTAAGCACGAAAAGGAGGCGTTTA
CACTCCCGCAAGGCACCCTTAAGGCCCAGATCGATTCTGGCCTCCGCGTCGTGATCT