Description :
From Genome Similarity Track
Location :
Scaffold_132:44759- 51503
Transcript NameFunction/comments
Phyra_84958Hypothetical protein
Phyra_72289ATP-binding Cassette (ABC) Superfamily
Phyra_97006AlNc14C514G12014
Phyra_84961adipose triglyceride lipase

Sequence
6744 bases(100 bases per row)
TGGATTGTCGTGCTCTTTTTTCATGTTTTCAATACGGGTTACTCGGTATCTCTCGCCTACGTTTATCACTACATGTCTTCCCCCGCAATGGACTACTACG
TCCAGCTGTTGCGAATGATGCCACAAGAAAACTATAATGGAATTATCGCTCTCTATGCCTGCATTGGGGCTGTGAACTTTTACAGTGCGCTGAAGATGTC
TCTCTACTCGCTGTACTATCGACGACTGGTCTTTCGTAAGATGGCGGATACGAATATCGACACAGAAGACGAGGAAGAGAATGAGGAAAAAGAAGAAAAT
GTAGGTGTTTCAACGAGATTCCGAGCATTAACACGTTTCGCGTCTGGATTTGCACGAGCCACCAGCGCTCGCGGCGAGTGGTTCGATACAGTTCTGCTCA
TGCGAGAGGTAGCCGAAATTTCATCTCAGACTGTGCAGGCTTACTCATCGAGCTATCTCATCAGCAGTGTCTGGATGAACCAGGTATTTGCAGGGTTGAT
CTTCTTGAACGCAATTGCTAACACGCTCGTGCACTACAACCTGGAGGGAAAAGTTGGTCTGAGGCGGTTGTACAGCACTGCGATTGATCTGTCACTAGAC
TTCGCGTGGGGTTTTATAATTCCAGGGAAGATCATATTCGTCTACATCTCGATGTTCATGGCAAACAACGGTTCGTTTCCAAACGAGTTCAATTACTCCG
ACACGCTCCAAATCAAAGCAATCTTGGAATGCAACCAGTTCTTCATGGTTACGTGGTTGGATGCGGTGACCACGACGTTGCCATACCTGAACATGCTTTC
GGGTCTGCGAAGCGTAAAATTCTTAATCCAGCACGACATGGAGGTGGTTCGTTTTATTTCATCAACGAAAGTCCAGCCTATAGGGCCGACGGCACAACTT
GCAAAGCTGCAAGGGGCTGTCGTCGCCCCAGATCCAGCGCAAAAGGCTCCAGGATTGGCAAAAGTCGCGGACTCCGAAGAACACCAGGTCGAAATAAAGC
GCAGCGTCTGTGGAAGGCTAACAACAGGCGTCGTAGCACTAATGCCTCTCTGTGGACTGTTTGTCCTGCTCACATCTATCACTTCATCGGGGGTATTCTT
TAGCGGCGAACGCACATGTGCCGTGGGTTGCAAATTGCACATGCACCCGTGGTTCTCTACGAAGTGTTCATGTTCAGTCATGGAGATGAACTGCTTCGAG
CGGGGTATCACTGGTCGCGAAGCCGAAACTCGTGACATTCTGCAGTCGCTCGACCCCAAAGTGTTGAACTCTCTCATCATCTCGCACTGCCCTGAGCTTG
TTATCACCGAGGACATTCGCCGGTTCAGCAATCTCATGGCTCTCGAGCTGTACAACTCGACGGTTGTAGAGTGGTTGAGTGCCGCGTCCTTGTCACTTCC
CTACATTCCGTCCCTCACGACAATATTTGTCGTGCGATCTCGATTCCTAGGCGGCCTCCCAGAGGGTTTAACGACCGATTTGTCGCCGAGTGTCGTGGAC
GTCGAGTTCGTAGCGTCGGATCTCGGTGGGCCATTACCAGACGACCTCGACGAGAAGTGGACGTCCGTTATAATGCTGTACTTGGAGCACTGTGGACTGC
AGGAGTTCCCACCTGCCATCACCAGGATGAAGCTGACGGATCTGTCCCTGGTGGACAACAACATCTCGGTAGTCCCGGACAGGATAAGCGAGAGAGCCAT
GTACGTTATGCTGGACCGCAACCCACTAAGTCACATCCCCGACAGCTACGCGTCTCTGCGAGAGCTCTTCTACTTGTCGTTCCAGTACACCAACATCGCG
TCACTTCCGCAATGGCTGCAAGATCTGCGAGCGGAAGGCGCCGGCATCAACTTCCGAGCGCTAGGCACGCCCTACTGTCACGACCTTCCACTCAACAGCT
CCGAGGCAGTCTTCGCCGCCTGCAACTGGGACGACTACAGCCACGGCATATTCCCGTTACCCACGAGGGACCAAGCGCGTGCCATCCGCGACTAACGTTC
ATTGAAAAACGAATCATTGACGCAATCGACCATCATTCTCGTTGACTTCTAAAGTCAAGAAAATCTTCCCTGAAGTCAAAAGTCCGCCGTCGGCTCAGTC
ACCTCCACTTTGTATTGCCAATGTCGCTGCTCCACGGCCGCAGCATCTTCCTGCGCGGCGTGCGGCGCCTCGAGGTGGTGCAGCGTGCGCGTATCTCGCC
TATCGCGTCCTCGCTGCGGCTGAGTCGCCGTCCGTTTGTGCTGCCTGCGCTGGGCAGCGGCGTGTTGAGCTTCTCGACGTCGGCGCTGGACGAGCATGAG
AAGACTAAGAAGGAGAAGAAGCAGCTGAACGCGCTGAGCGGCATGGGGCTGGACCGCCCGCCTGACACTGGCAAGGAGATCCTCAGCTTCCTGATGGGCC
ATTTATGGCCTAACGAGGACACCAAAGAGGCCAAGGAGATAAAGCAGAAGGTGCTTATCTCGGCGGGTCTCGTGGTGGCTTCCAAGGCGCTGACGATCCA
AGTGCCGTTCATCTTCAAGGATCTGGTGAACAGTATGGGAGAGGCCTCCAGCGTAATGGCAGGATCGCCTGAGATCGCGGTGCCCCTGGCCATGGTGCTC
GGATACGGCCTCGCTCGCTTCAGTGCCAGTGCGTCCTCGGAGCTGGCCAATGGCGTGTTCGCTACCGTGGCGCAGAAGACCATCCGCAAGGTTGCAGTAC
GCGTGTTCAAGCACTTGCATGCGATGGACCTCAAGTTCCACTTGGACCGACAGACGGGAGCGCTGTCGCGCATCATTGACCGCGGCTCGCGATCCATTGA
TTTTGTGCTGCGTGCGATGGCGTTCCGGGTGGTGCCGACGGTGCTGGAGATTGGACTGGTGAGCACCATCATGGCAACGAGTTTTGGGCTGCCGTATGCG
GGTGTCACGCTTGGTACTCTCGCTGCGTACACGACGTTCACGGTACTGGTCACGCAGTGGCGTGACGAAATTCGCCGTGAGATGAACCGACTTGAAAATG
AGGCTGGCGCGAAGGTGATCGACTCACTGATGAATTACGAGACTGTCAAGTATTTCAACAACGAAGATCACGAGACTGCGCGGTACGATGAGTCGCTGAA
GGGATACCAGAATGCGGCACTCAAGACGCAGACGTCTCTCGCAATGCTGAACGCCGGACAGAATGGTATCTTTAGTGTTGGACTCATTGCTATCATGTAC
ATGGCGTGCGAAGGCATCGCTGCCGGCACGCTCACCGTTGGCGACCTGGTGCTTGTGAATGGTTTGCTGTTCCAACTGTCCATCCCGCTCAACTTCATTG
GTAGCATCTACCGTGAAGTGCGCCAGTCGGTGACTGACATGGAGTCGATGTTCAAGCTTGGTGCTGTTTCGCCCGTTATCACGAACCCGGACGAAAATCT
GAGCCTACAGGGCAAGGGGCCCAAGTCGATTGAGTTCCGTGACGTGGACTTTGGATACCGCCCCGAACTTCCGATCCTGCGCAAGACGTCCTTCAAGGTA
GACGCTGGCAAGCGTGTTGCTATTGTCGGCACGAGTGGCTCTGGTAAGTCCACAGTGCTTCGGTTACTCTACCGCTTCTACGACCCACAGAACGGTACCA
TTCTTATCGATGGCAAGGACATTCGCCAGCTGAGCCTGGATGAGCTGCGCCAGGCCATCGCTATTGTCCCTCAGGACACTGTGCTGTTCAACGACACGAT
CTTCTACAACATCAACTACGGTCGTCTGGACGCCACGCCTGAGGAAGTGATGAACGCTGCCCGCGTTTCACAGATCCACCGCTCGATCGAGACGTTCTCG
GACGGATACAACACTCGCGTGGGTGAGCGCGGACTGAAGTTATCTGGCGGTGAGAAGCAGCGTGTGTCAATCGCGCGCGCGATGCTGAAGGACTCGCCGA
TCCTGCTGTTTGACGAGGCTACCAGTGCCCTTGACTCGGAGACCGAGTCGGAGATCGTGCGTGAGTTCGCTTCCATCGGTGCGAACCGCACGTCGCTGAT
CATTGCTCACCGTCTGTCGACCATCCAAGACGCGGACGAGATCATCGTGTTCAACAAGGGCCACGTGATCCAGCAGGGCTCGCATGAGGAGTTGCTGCGC
GACGTGGAGGGCAAGTACGCCGAGATGTGGGGTCGCCAGAACAACCACGTGCTTGGTCTGCTTGGCGCCGGCGACGACGACGACGACGACGAGGCCAATA
CCCTGTAAATTGAACTCGACCACTTCAACTACAACGTTTTCTGTGGTTCACACAACTATGTCATTCTTCTATTTAGTGACAGTCTAGAGCCAAAATAGAA
TCGCAGCATCGCACACACCAGCTCCCTCCGCGATGGACGCGCTGCTCGTGGGCGAGGGCCGCCTGAGCAGCAGCTCCAGTTCCTACAGTTCCAGCGACGA
CGAGCCCTTGAGTCTCAGCCTCAAGCGCCACGGCGTGATGGCGCCCCCTCCTCCGCCGGACTCGCCGCCGCCAGACATGATGCCGCCGCCGCCTCCGCCT
GGACCGCCTCCTCCCGTCGACACGAAGCGCAAGCCGTCGAGACCGCGGCGATCAAAGACCAACACTCCGACAGTCGAGAAACGGGCACGGAAGGTGACGC
CCAAAACGTTGGCCAGGAAGCCGAGAGTGCGACGTCAGGCGTCTCCCACGAAGCAGCAACAGGTTGAGACGCCCGTCGAGAGTGTGGAGGAGGAAGAGGA
GGAGGAGATGGACGAGGAAGACTTGGACGCGTACTCGGACCAGTCTGACGTGTTCGAAGACGACGTCGAGGCCATTTTGTTCGCGGAAGAGGAGGAGGAT
CGTAGCAAAGGCTACACGGACTGTCTGACAGAGACCCACTTGGACAGCGCAGAGTACCCGTACCCGGCGTACCTGGCCAAGCTGTCAGCACTGTTTACGG
AGCAAAGCGCTTTCGGGAAGAACCCCGAGGACTTTATTTATTGCAACAACCTGCTGGTGCGTTCCCGTGGATTGTAGTGATGGATCTGTATCGTAGTGAC
TGATGAGGGCGTTTCGTGTTTGCAGGTTAGTCCGAGTCAACTCAAACTTATGGATGAACGGACCGCTGCACTAGAACGTGGGAAACTGGAACAAGTGCGA
ACAGCAACAGCGTTGAAGGCGAAGGAAGATGAAAAGAGGAGAAAGCAGGAGAGGTGAGAAGAGTGTGATTAAGCATGCGCAGAAGAGTTTAACCGTGTTG
AAAGTAACGCTGACATTTTTTGTGCTATTACAGACTGGTCGAAGCGCTGGAACCGCCTGCAAAGAAAATTAAAATATCAGAAGCCACGCTGAAGGCATTG
GAGTCCAAACAATTAGTATCTGGGAGCACGTCCAGACCGACGAGAAATCCAAGTCGAAAGAGGAGTCGAAAGAAACCTGCTGCACCAGCTGCAGCACTTC
CTGCAGTCGCGACAGGTCCGTTAAATCCTCCTAGTGACGCCTCAGCGGGTAATAGGCAGCAGGTGAAGTCACGGTCGAAGCCGGCAAAGGCTGGCAAGGC
GAATGGGAAGGCGAGTGATAAACCCGTGACTACCTCAGCTGCTAAAAAGAAGACGGCGACTGCCAGTAACCGGACGAAGAAAGCGACAGCCACAACTACC
AAGGCAGCAACCAAGGTTGTGGCCAATGGCACGTCGAAAGCGATCATTTCAAAAACAACCAAGAGTGCCCAAGCTAGCCAAAAGCCAGTGGTGCCTGCTA
GTAGCGCAAAGGCAACGAAAGTTGAAGTGGGAATCGAGAAGAACCGAGCTGGGGGGGAGGAAGATCCTGGCAACGAGAGCTCGTCTTCCTCATCCTCGTC
TTCCTCTTCGTCGTCTTCTTCTTCTTCGTCTTCTTCGTCAGTGTCGTCACGCTCGTCAGCGTCCAGCAGCTCATCTGACAATGACACTGGTCGTGACGAC
TAGACGCACAGAGCTGGTTGGGCTTAGCAGAACCGAAAAGTTTTCGCTTAATTTTTAATGCTACTACCGTACGCGGTTCTCACAACACATTCTGCTGATC
TTTCTTCACCTCACCTCGTCTCACCTTCGTCAACTCTAGGCAGTGCTGCCTGCTTCTCTGCCCAGATATTTGCTGACTTTTGCCCCAGCTCGAACAGTCG
ATCCAGCACTTCAATCTGCGGTGGGAAAAGTGCAAAGCGAGCCAATTGCATAATCGTGAACGGGAAGTCCGAGTCGATGGACGGACTGATCTCGTAGTCC
TCCCGACGTAGTATGTGGGCGTGGAAGGCGCACACCTTGGTGTATCCCGGTACTTCCGGCACCAAAGTGAGGAGACCTCCGTCCACGTGGTACTCTCCTC
GAAAGACCGACGTGCCCCGCCTCGCCAAGTACCAAGGCACATAGCACGATGCAATGAGCGCGTCGCACAGATCCTCTGTCGAGTGGAAGTCGTCGGTGAG
CACCAGCGCTCTAGCCGGCCACATTTTCTCCGTGGCGATCGTGAGGCGCTGCGCCAGCGTCTCCACGGGCAGGTCGCCGAACTTGGTGTGGAAGATGGCG
CGCAGTCGCTCCTCGAGCTTCCAGACGGTGCCGTGGCTATGGCAGAGTCTGGCCATGGCCTTGGTTTCCTCGAGGATGTCGCGCGTACTGGCGTTGGCAG
CCAGACTCAAGGCCGCAATGGCGCCTCCTGAAGCTCCGGCGAACTTGGAACTGGACTGGATGTATCCGGCATCCTGGAGGCCCTGCGCCACACCCAAGTG
GTACGGGATCAGGAACCCGCAGCCACTGAAGCTGAAGCTGTGCG