Description :
From Genome Similarity Track
Location :
Scaffold_15:44738- 49981
Transcript NameFunction/comments
Physo_534414Hypothetical protein
Physo_343539Hypothetical protein
Physo_534411Hypothetical protein

Sequence
5243 bases(100 bases per row)
GTTGGTGAAATAATGACCGGAAATGTTTGACCATTTCTTGTGCGTGTATCACGAACGGGAGCTGTGCTGAAGGCGTCCAGGCGGGTACGTCAGATAAGAA
GACCTCCTGGATCGGCTCACTGCTGTTGCTGGGGATCAGCAACCCAGTATTTACGACACTGGTAGTCGCTGAATTGGCTGGTATAGCTGATACGTCTGCT
GCGACCACCTTTAGAAGGTTTGAATCAGCATCAGTCTTTGGGGCTTCGTTCTCAGCCGCTTTGGCAGTATCAGTTGTCGAGGACAGATACTTCATAGCAG
GCGACTGAATCATATTCGGATCATCAATGCAGAGCACATTGTGATCCTCCTGCTCCATCCCCGCCCAGTTCTCTCTCTTGCGACGTTCCTTCGCTTCAGT
TTCCAGTTCCCCACGCAGTCGAGCAAATAAAGTATGAGATTTCACAAAGAAATCCATTTTCATATACGGAAGCTGCTTCTTCCATGATGAAGGCGACGTT
CCAGCCACAGCTGCTATCCAGTCCATCGTGCCAACATATTCTTTCTCTAGTTCAAAAGGGAGTTGGCGGTGCGCCACTAGTGTTAGCTGGTCGAACTGCA
GACTTGCAAAGGCAGCGGCGTCGATTGAAGACGCGCGGCGCGTAATTTCTGTATCGGGCACAGCACTCAGCGGATTCCTCGGACTTGTAGCAATCCACCG
ATTCAGAATCCGAAAACTTTCTCGCAAATGAAGTCCGTAAACTAACGGTGAAGTTCCGGACGTAACCAGCTCAGGGTGTTCTAGCATGCTTTGGAAGCGC
AGACGACTACAAATCCATTCACACAGCAGCTTTCTGTTCCGACGGAGTAGTAGCGACGAAGCGGAAGTTGCCAGAGGTTCTCCAATATCCGCACCATCGT
GGACAACACCCGTTTTGAGGATTCGGTGAAGAGCTTCACGCTCAAGCAGAAGTTTGTAGGTCAATTCGCTTCGCACATCATATCCAGAAACCTGAAAGTC
GCCTCCACTGTCTTCGATAATGCTCACAAGGACCTGTCGATTCTGAATGCGAAGTAGAGATTGGTAGCGCTTGGAGCGTTTCTGAGCAGGAATGTCATGA
TCTATCCGCGCATGTTCACTCCCATCATCGCATTTACAAAACCTCACATGCTTCAAAAGATGCACCAAAAGTGTCGGTGCGTACGAGTTGGACTTGACGC
AACTTATCCAGAGGCGAAGCATCAACGGTTTGCTGCTTAGAAGGTCAAACACGACTCGTAACGGTACTTCCAATCGATAAAATTCACCACTCGCTGTGTG
ACAAATAGCGAAGATCAGATCTCCCCAGTTCTCGTACACCAATGCCAAACACCGTAGCGAGCAAACGATGTTGCCACTGCATTGCGTGCCAAGTTCGTTC
GATCTCGAGGCTACCCTGTCGAAGATGATCATGAACATATATCCCCGAGAACTTCGAGAAAAAGAGCTCCACCATTTGCGGGCGCTGGATACGTCGGTCA
TACTGTATTGTTTTCAGCTGGCCGTTGTCTAGGATGAGCTTGTGCCGTCGGCGAACGCTATCGTTGCCAGGAAGCGCCGTTCCGCGGTTTGAGATGAGGC
ACTTCGCTTTGCGGTCAGCCCAGCAGAGAGCATACATCGCGGTGCCTTTGGGAGTTTTGCTCTGTAGCATCTTAAATGACCCACGAGCGGGCTCAGAACC
AAACCACTCTGTCATATACTTTTTTGGATACTCGCGAGACGCTGTTTTGACCATTCCCATAAAGTAAAGACCGCAAAGATTTTCAAGTTGCACAAGGGTT
TTAACGAAGCAAAAGCGCTGTCTGCAACAACGGTGCGCCCGCTACCTTTATAAACTTCAGAAAACCGCAGAACAATCGCTGAACCCTCACCAAACAACGC
GTGGTATGGCTTCTGGCGTTGACGCTCGGCTCCCTCCATCAAATCTAACCCCAACAGCACACCCGAATCACCATCAGCGATAGCTTTTAGTTCGGCATCC
ACGCCTTCTGGCTTTCTTGGGATTTTTGTCTTGTGAGGTATGCCATCGTGGCAGTATTTACCCTCTTTGCCCTGCTAGGCGCTCATGCACTCATCCACGC
AAAGAATCTCCCCGGGTGATACTACATCGCGGCGGCGTGAATTATATCAATCTATTAGCGGTCTTATAGATTTCCATGGGTCATCTGACGGCACATCATC
GGAAAAAGAGAGCGCAGCTGAAATATTTTCAAAGGCATGTCGTGTAATGCAGAAGCGCTCACCAAAGTTTGCGGCTGTGCCAACCATACCCTCACCAACT
TCTCTTTCCCAGTAGGTCCGCAAGGGACCGCGTCTAGGCTCGACTGCCATCGCAAGCCGAACTCCCAGAAAGCGAAACAAATCTCCCTCAGCAATTGGAC
GTTGCTTACGCTCCACCAACTTGGCATTTGTGTGCTGTAGAGTAGTTTGTATGGTCGACCACGGGTACATCAGAAAAAAATATTTGGCGAAGGTCTTTTC
TCCTAACTCCAGCGTCGCCGGCCAGCGAAATTTTTTTTGCGCTTGCGTTGCAAAGTTGCAGGGTCGACAAGGAGGTCGGAACAAAATTCCCAGATGCGGT
TGTGGGCAAGTATTTTTCCGTCGTTAGAAATTCCAGAGACCATCGTAGACGTATCATCTGCGTTATCTTCTTCATCTTCCTCCTCGTCTGAAGAGGATTC
CGACTCAGAAGAAGACGAGTCACCCGGACCAGGCCCCGCACCAACACCAGCTAACAGCAAAGCGGCCATCGACTCTAAAGGCTCCGTAGTCGGGTTCTGC
ATGGCTGAGTCGCTGCTGGGAGCCTGTAGTAGCTGTATTGAACGCGCCGACACTGACTGTACTGATCCATCGCCCCACTGAACGCTGTACCACGGCTGGC
GTTTGCTGTTGTCGATCGACAGGACAACGCCCTCCTTGCCCAGTGTCCCCTTAGACTTTCCTTGAACACGATTTCCAACACCGAGTTTCACCGTGAAGAC
AGCTTCGTTTGTGACCGGAAAAAAAGCGCTGAACAGCTCAGACCTTCCTCTCTATTTATAAACGATATACGTACACTAGCCATTCCCAGTAGCTTCTAAA
GAAATATTTATAGATGGGCCCACGCGTGGGCTCTGTGGGGAGTAAAGGTTACCTCCCAGCCTGGGTACGGAGACAATAGCAGCTGACTAATAGTCAGGTG
GGGTGGGATTTTTGTTCTTCTCCCGTCTCCACGGGCGCTTCTTGAATACAACATCCTCCATAAAGTCACGGCATGTGATCTGCTCGGCGACAGGAGCCTT
CGGATTAAGGCAAGCTTCAGGCTTTGCGCGCAAGAAGTAGGGCATGGACATTCGGCGTTCAGCTTCCGCTTCCACACAGATCGGCGGTACACGATGCAAC
GGCGCTGAAATGACCCCGTGGGTCAGAAGGCCAAGTGTCTCTCCAGCAAACACAGAGACTTGCAGTGGTGTGGCGCTTTCACATCGGCCCATACCATTCA
CTCCAAGTTCCACATTTGCAAGCCAGGGACCGTGGCTAAAGGCGACACCGTCACCAGTCCGAGATCGGCATGCACGCCACAGGAGTTATCGTTCGGATCC
ACCTCGGCTGGTCCCTTACCGTTTGCGGCCTTGTTGCGGTAGTTGTAGATACGCAGCACCGATGCGCCATATTGATAGCTTGTATCTCGTGGTCCTTCGT
ACGTCTTCGACGCACGCATTCTGTCGTCCAGAAGTTCTTCAAACAGCCAGTTCTCGTCGATATTAAGCAGCTCACAGACGGCCTTCATGCAGCTTCTCGC
CATATCATCGAGCAGTTCCAGGAGTATCAGCAGGTCGTTGGCAAATTCTTAGTTCTCTTCACTGTCTTGGAAGTATACCGGAGGCCACAGCGTCCCACTT
GCAGCGATAGGAAGGCGGAGCTGCAAGTATTCTCGATTCCGATCCGCGCTAAACCCCACACGCCGTCCACGTTACACCACCGGGTGCGAAGTGTACAAAC
TGTCGCTCGGATTGTCCTCCACGTCCTCTTCTCCCTCCTTCTTCTCACTTGGCTTGCTCACGTTCACAAAGTCAATCCATCTCTTCTCCTTGGGCAGCTC
CAACTGTTCCACCAGCCACTTCCTCACCCTCTCGAATGCAACCTGCGGGATCTTGGCCTGTTCCGGCGTCACCTCTAGCCTGGCGAACCCGTAACTCTGC
ATGTTCTGCACAAAGCGACGTCGGGCCAACGTCCTGGCGACTGAATTGGTCGAGTCTGGAAAAAGTCTGCCCTGTGAAGGAGTTGTTAATTGCTGGAGAT
CGATGGAATACCTGGCCTACACATTACTACCGCGTTCATGCAGGGATACTGTGTCACACAGTCGTGCCGCAGTACAATGTCCACGCGATGTATATTCTGG
AGAATTCCACGTACAACCGGACATCAGCAAGTTGTTCCGGTCAGATCATTGCCTTCCATGGAAACTTCTATCACGGTAGTATTGGTTATTACGCAATCTA
TGCAGAGACACAAGGAGCATATTGTATGCAGGACGGCACAGCCTACCTTACCGTAAGCGGACGAGGCAAGTACGACATCAATGGACTGCGACTCGCTCAA
GACAGAGGTGACGTGGAGTACAGTGGTACATCTTTACTGGAACGTCCTTCACCCTCGTCAGGATACCGACGCTACGGAGAAGCTTCGTCTCTTGTAGGCG
ATTCGCAAAACACTGCGATCAAATGGCCGAGCCAATTCGAATACAGGAAGCCATCGTTTACGTCCAAGAGAGTATGCGGCTGTCGGCTCACGGAGCCAAG
AACGTCCACCGATTATTGCTGATGTTCCTCCTCGTGGACCAGGGAGTCATGAGCGACTTCTTCCTCCTCAGCCCCCAAGAAGTATTCTTCGGACGCATCC
AGTCCATCTCGCTCGGCTACAACTTGGCAGGTCTTATGTCCATGGTGTTCGAGATGGTGGAGACGATGAGCTGGATGAGCGAGAAGCTGCGGTGCCAGGT
GAAGCGACTGCTGTTCAACTACGAGACGGTGCTGGTCGGTGAGTTCATCACTGCCGCCGTCCTGCAGCACTACCGACTCAAGGATACGCAGCCGGCAGCT
GAAGTGGTGTCATACTACGTCATGGGGTTGCTCGGGCATATTGTGCTCGCCTTGGGATGCCTTACGATCATCGTGTCCACGAGAGCAATCGGTGCAGTCG
GATTTGTGCGGTGGAGGTTTTGTACCATCCGGGTGCTGACGAA