Description :
From Genome Similarity Track
Location :
scaffold_6:44727- 74602
Transcript NameFunction/comments
Pl_112760hypothetical protein PHYSODRAFT_426731
Pl_112761hypothetical protein PHYSODRAFT_467823
Pl_112762copper-transporting ATPase, putative
Pl_11276360S ribosomal protein L6, putative
Pl_112764hypothetical protein PHYSODRAFT_475090
Pl_112765GTPase
Pl_112766phospholipid-transporting ATPase, putative
Pl_112767conserved hypothetical protein
Pl_112768myosin-like protein
Pl_112769myosin-like protein

Sequence
29875 bases(100 bases per row)
CCACCTGGTCAGTAAATATAGGAGTTGGAGCCAGCCGATCAGCTCACTTTTCAAAACGCCAAGTGGGCTGTACGAAGTAGTTGGTAGAACCAATGGGCCC
CGTAGTTGATGCTCCTTTTAAACTGATTTCGCGGATTCAGGAAAGTGTCAATGGTCTTCAGTGTGTGGATCTGGTAGAATGTCCCGTTTCAGGTCAAGTA
TTCATTGACAAGCATACGTTGATGACCTCGTCGACTGCTGAAGGTCGCAATGTCAGTGCCGCTGCATTGCACGAATTGGATCTCCACCTTTCGGTTCAAG
ACACCGAGAACATCGTCAAGTTGGAGCAAAATTTGCTACAAGGAGAGCGGCTTCACCTACTGCACGAACATTGTGCACGCGGTGACTTGCTTGAAATCAT
GCAACAAGAACTTCGTCTTCAAACGGCAGGAGTGCCATCTCAAAGCTCTTCGATGTTGACTTGCACCGACGCCGGACGACGCTTCATTTTCACCTCGGTT
CTTCGAGGTGTGCAGGCACTACATTCCGCCGGAATCGCCCACTTGGACTTGTCACCGGAAAACATTTTCGTCACGGAATCCGGTGTCGTTAAGGTGGGCG
ATCTAGGTCACGCTCAACGATTCAAGCGCGAACGACCAAGTGTTCAAGTCCTACAAGTTGCCAAAGAGACATACGCTGCACCGGAGCTATTACGTCACAC
TGGGGTGGAAGATGCACGCCAAGCTGATGCGTGGTCACTCGGTGTCATTCTGTGGACGCTGTGCACCAAACGAGCATTGTTTCGTCGTGCTTCGAGCGAC
AGTGGCAAGCTTTTCAATCGGATGGTTGAAGTCGGTACGGCTATCGCTCTCCAAGAGACTGGGTTGTTATCGCAGGTGCCTGCTGCATGCTTCGATCTGC
TCGTTGGTCTCCTTGATGTGAACCCCAAATCGAGACATTCAGTGACGGCAGTGTTACAACACCCGTGGGTGATGCAGGGCACTGCAACAACCAACCCGCG
GTCGCGACGAAAGTCTATTGGGAACCTGTTCAAGAAGAAGGGTGAGGAGTTGATGAAGAAACACCAACGTACCAGTGAAAAGAAGACGCGAGTTCGCACT
GCGAGTGCAGAAATTGCACTTGAATCCACGCGTGTCACCTTGACATCTCGAAATCTAGCATAGACGACAAATGCCATTATTCATGTCGTTTGACATCCTT
ATAAGTACTCGCAGCGAGTGCAGAATACCCTACTAAAAACGGGAATGAAACGCGAAACCAACACCTTTGTCTCCGTTCCTTCCAAGCCGTCGCATCAATT
GATCAACTTCACTGCAGCGGAATTGTCCTTGCTCGACTCATTCACGAGTTTGATGCGTCGGCATTTCCTCTTCGCTGAGGACGAAAAGGAGCGGAGTGTT
GGCGAAGGTAAGGCCAATCTGCTTCGACTATGGCACAATCGTCGAAATGCCATGCTGGATGGCGACACGTCTGCTAGTGGAGGTGAAACGAATGCGTTGG
TAGCACGGGAATTGACGTTGTTGTGGGATTTGGCCAAACCCATGAATGCCTGCACTTTAAATCGTGAGGGATACGTCGCATTTTTCTCCAGAGCTGCAAA
AGCACTCGTACTTCCATTGTCGACCGATACACTAGCAATTGCCGCTGCACAACGTGACTGGGAATACGATTCAGAAGGTGTCGATAGCATCAGTGATGCC
ACCAAATCCTCTTTGAATTTGGACAATGAAGTTATGATACCAGAACAATTTCGCGAGGCAGTCATGCAGCTTGCAGATATTATTCTACCCGTGGAGAGTG
CAGCCACCATTTACGTGACTTTCTTCCGAGAGCTTCGTAATTCTGTTGCGGAAATCGTATCTCCTTGCAATGGTGAGCCTGAGCAAGATGAGACCACTTC
GACCGATCTAGTTGATCACTTCACGCTTCGACCACTAAAGCACATTCCGAAAATTGCGAACGACGCATTTCTACAAAAACTTCCTCCATCCAGTGATGCT
ATGCGAAGTATTCGGGGACTACAACCACCAGACCAGCGAGAAATGTCGCTCAAGCAACTGCTAATAAGCTACAACCCACGAAAGTTCTCACTCACTCGTG
CTTTCCCCATTACGAAAGGCGTCAATGGTAGTATTACCAACACAACCGAGGAAGTCAAGATAGATACCCCCACAGATAACACTGAAGACGATATGAAGAT
TGTAAAACGACTACATGCGGAGCTTGTGGGGTTTATTGGTTCCGGAGCAACCCCGGTTCGGAGTAGAAAACTACATCGTGAGACTGCAGCGCACTGGGAT
TCTGAAAATGCACTCAATACTGCTCTTACCGAGTCTCCATCATTGAGAATAGCAGTGGTTGGACCGCCTGGAAGTGGAAAATCACGACTTGCTCGTGTAT
TAGCACGACGACTTGGGCTGAAATACCTGTCCCTTAATGGAGCCGTACAACGCGCGTTTGATCGTAAGCTGCGATTACGTCGACAGCGAGCCGCTGTTAC
TGCTACACCTACAGAAGAAGAAGAACTTGGTGTCGAAACACCGCCACCAGCGGAGACAACAGAAGAAGGTGAATCTATCGCAACTGATATCACTGACGCT
GACGTAGATGAAGAAATGGACCGAGTATTTCGAGATACAGAGTTTGATGCACTATCCACAGGAAGAACTCTAGCTCGAGAAATGGCGATGGCATTACTTC
GACTGGAAGCCATTCGATCCTTGCTCGGTACGTTTGTGAAGCAACAATTGTAATGCTTATTTGACACGTTTGCGATCTTGTGTTTTCATAGGTGGTGTTG
GGGTAGTCGTGGATGATGTGTACCCGAGCGAATTGTCGACTCCAGATGATCCTAAACACAGTATAGTACTAGACTACTTGGTTGCACTCACAGCACTACC
TGCTGAAGTCGAGTACCAGCTCAAAGGCTCGGAATTAGCACCAGTCGCTGGTCGTTTGTACTCTGTACGAGAGCTTGCCACTTTGAAAACGACAAATGTC
GAGGAGCTGGCTGCTAAGGGTTTTGCAGATTTTCTCTTGCCACCGAAGACAACGGAGGTAGCCGAAGTATCCGAAGAATCAAAGATTGTTGTTGAAAACG
ATGAAGCTGCCCCAAACAACGAAGGCCAAGAAAGTGACCAAGAAGAAAACGGAGATAGCGATCACGTTCTACAGGAAGAACCTGTGTTACCGCCAGAGCC
GACTCCTGAAGAACGGAATGAAATTGACCCGCCCAAAGAGCCCACTTTACCCTTTGGTGCGATCACAATGGTAAAAACCGTAAAACGATATCACGAATAC
GTGACACGAATGCAACGTGAGCTTTCAATGCGCCGATCTGGAGACACGATGGACAAGCAATTAAACAGTCATTTGGTCGTAGTACTGGCAACTCAATCGC
TTGATGTGATCCGAGAACACTGCATCCAGGCGATCACAGGTGTAAGTGGCACGTACGTTTGTCTTTGCTTCTTGACACTCAACTTTCTTATGGTGTTGGT
TATATGTTTTAGACTTCACTTGGTCTGTCGCGATTTAGCACGTCGCGTGAAGTTTGCCCGATAACTCTGCCAGAGGATCTGAACGGTTCCAGCCGTACTG
AGAAAGTTAGGTGGCTTCTTTACGGAGACTGGAGCACACTTCTTGACGTCGAAGCAAATGCCACCAACGAGTCCTTTGCACGACTTCCTAGACGTGATGC
CAAACGCAGACTGTTATCGAAGTGGCGTGAATTTTGTCCCGTTTTGTCGATTTCTACTAATACTCTGAGGCTAGGAGAGCCTGAATTTGCGGCATATTAC
TCCGGTAGGGTCTACTTTTTGGTATCACAAGACGCACGACGTGACTTCTGTGAACACCCACTGCAGTATTTACTCAAGGATATCCCAACTCCATCCAAGT
ATCGAAACTTCTGGCTCGTGACCACAGGTGCAGGCGAAGTCTTCACACCTTCATATTTGGAGACACTCGAGACTGGACTCCACGTACAAGCAGTGTCTCC
TTCAAAATTGCTCAAGACTTCACCAAGCATATCCATGGAAATGCGTCTGATGAGTGGACAGGTTGTCACCCCGGTTGAGGCTGCAATTGCCGCGGCCGAA
GCTGTCAAAGCTTTGGTGGCCAAATCCAACACAATGCGGTGGATGATCACGGACTTGCCATTAACACGCGATGTTGCTGCTGTGTTACTTGAACACGGAT
GTGTGCCCGATGCAATTTTGTTGTTGGATAGAGAACTTGCTGCTGCTCAAGAAGATGAAGAAGGTAATAATACCGATGCTGTTAGCACTTTATCTGTGCT
ACGGCGTCAGCAATTTCAAGCCGAAAAGGCAAGTGCTGATGACATCTCACTAGGACTTGGTAATGCACCTCGAGTGGTAACTTGTCCACTGTACCGCCAA
CCGAGTAACTCACTGGCAGCCATCGAACGCGAGCTTAACCCAATTGCACCACGCCTGGACAGTATTGAAGACGGACATGCTCCACAACTTGTTGATGAGT
ACGATCCAGCTGTGATATTCGCACCACCAGTTCCTGAGAGGGATGAAGAAAACCAGGGAACACAAACGCCAACTCCAGGAGGAGAGGCAGATTCTGAAGC
CACTGACACTGAAGCGGATGTTCAGGCGGAAGCAGCAAGGAACAGAGCATTACAGCTTCAGGGAGAGTGTGGACGTTTTTGCCCTGTGTCTTGGTGTAGT
CGTGGACTGTTGATTCCTGGGCTACCCTCCACCATTTGCTCATTCCGACAAAAGTTTTACGCTTTTGCTGGCATGTCAGAGCTCCGCGCTTTCGAACAAA
ACCCAATTGCTTTCATCCCCAAAGGTCCTTGCGCAACAGCGAACTTTGTGCCTTACATACTGCTGCTTGGTGTTCGTGGCTCTGGACGTGGTCGAATTGC
AACGCTACTAGCTCAGTCACAAATGGAACAAAGTGATTCCTCTGCGAAATACTTAAATGTGGACCTGGCTGTAGTTGAAAAAAGCGCCGAACGCAACGGA
CTGCTAGAGCAACTCAAACCGGAAGAAACACGCTCCACGTCCGAAGAAGTTTTTGTCAAAGCGCTTCAGTTCGAGCTTCGAAGAAACCAGCCATCTCCTG
ATAAAGCGGTGGCACAAATTATCGCAGGGCTGGGGCCGGAGCCTTCACGCATCCCGACTGCACCAATTTTGGAGACGTGTTTCAAGAACGGACTCTTTCC
AGCACTCGTGGTTCCTTTGACACTGTCGGAAGATGACGTCGTGAACAAGTTGTTGGGTCAATGGGCTTCCAGTTTACCAGCGCCTCGACGAAAGCTTGCT
CTCATGCGAAAAAAAGAGGTAGATGGCAATGCTGAAGACGATTCTAATTCTCCAGAAGACCCAGAAGAAGAAGAAGAGTCCATAGACTTGGAGGCAGCGC
GGGAAGAAGAGAATACTCGATTGCGCGAGCAATTTGCAGAGGACCAGAAAGTTTTGGATGAGGCCATCGCTGGACTTCGGGCTCGAGGAATCCGAGTCTG
CAATCCTGTGGATGCTTCCAGCGCACCAAGACAAGTGGTCAAGCACGTGAGGCGCATCCTTGATGAATTTATGGCAGGACGGGAATCTCAATTCGAGCGC
TGCGAAGTACTTGACATGACAGCAGGAGGAAAAGTGCATCAGCTGCTTGCTTCAGGAGAACTTCTAGTTGGTAAGCACGGACTTGCTTGCCCCGTTACTG
GACGTACGGATTCTCTATCAGGTACATCGGTGAAAGCAGTGGTTTACCGAGACCAGCTTTACTTTCCGCGATCGCGTGAAGCTCGTCATGCCTTTATGGC
TTGTCCCTCAAGGTACTTAGACAAAGTAAGTCTTCCACCAACGCATCAGTCGACTTGCTTTGTGATCGGCGCTCCGTTATCAGGCAAGACGCGGGTAGCT
CAGGGAATCTCAAATGCACGCGGAATGGTCTACGTATCCCCCCAAAATGCAGTAGACTGGGTGGTTCAGTGTCAAGGCGGCTCTACATTACGGTCTCGAT
TGCTGGAAATCATGGGGCAGCAGCATGACCCTCTAACCAACCCTGAAATCACACATGAGGCTATCTGTGCTCGTCTGCGATCCTCTGAGTGCCAGGCACG
TGGCTGGGTTCTTGACGGGTATCCACTGCAGCACCATGAGCTTCAATGTATTGTTCCAAGTTCCAGCACAGCAGAGAATGCATCGCAGAGTATTCAACCA
GATATGCTCTTCATTCTAGAACGTAGCATCGCTAGTGTCTGGCAGGATCATCAGACCCATGTCGATAGGAACGAACTTCGAGCAGCATTCGCTAGATGGC
ACCATTATCGTCTGGAGCTACTTGACACTTGGATCCGATGTTTTGGCAGTTTTCACGTACGGCAACTTGATAGCTCGACTAATTCGCTGTGGTATGTAGC
CGGTCAGGCGCAATCATTTCTGAGAGAGCAGCAGCAGTTGGCATCACACTACACCATATCGATGGCTTCCAACCGAGCTACCCGCTCGTTAGGCACTATG
CGCACGAGTGACAAGTTACAACATCGTCAACATGACATTTTCCAGACGTTTTGTCCTGTCGAGCTGCGTGCCAGAAGATTTCACAACTCTCGTCAATCAA
ACAGTGAGTTATGCGTTGACTTCCGGGGCTTTACATTCTGGCTTGGAAATGAACGAAGCCTCCAGCAGTTTGTCGAATGCCCTGAGGCTTTCGTCGGATG
CTTGCCAGATCAAACTCCAGGTCTATACGGAGACGAACCATGGCCTACGGTAGAAGAAGCGGAAAGCGAGGCACAAACCCTTGTGGATAGAGCTCCAATA
AATGCTTCACTCTTGAGCTTGCTCACTGTAGCGGACTGCGACTTCCCGGAGATGAAAGGCTACTGCCCAGTCACGTTCGCATCGGGGTCTGGTGCCAAAG
ATTGGGCCGCACTTCGTCATGGCAGCGTTTTCTTCCGCGCATCATACCGCTCAAAAGTCTATTTCTTCGTCTCTGAAGAAGCACGTCGTAAGTTTTGCAC
CGAACCATCTCGCTATACCTTACAGAGCTTACCAGTGAAGTTACCACCCCAGGTAACACTTGCCAAGAGCTATCCAGGACAGTTGGAGCAGCAACTTGGA
GCTGCACTCAACGAGGTACTTCTCGCACTGGGTAGTGAACGTCCCAAATTTCCCCAAATGTCGATGCGCAGTTCAGCTTGCATTTTTCTTGCTCTCTCGC
TCAAGGCACTGCAGCGCCGTTATCAGCTGAAGTTGAAATCTGATCCACATTCGGCACGAGATGAAGATGAACCCGACGAGGAGCAGAAGCAACGACAGGA
ACGACGTAAGGAACAAGCTGAACAAGAGGCTATCGCAAGACGCGACGCCTTTGTGAACGATTGTCGACTGGGAGAAAAGCTTCTGACCGCTTCCACACCA
ACGCATCCATCCTGTGGCTCTGGAGCTAAGGTTGCACGCAGCATGCGCGCAGCACATAACTCGCAAGCCGACAATGAAACAGCGAGCTGTCATCCCCCAG
TAGCAGTCAGCGAAGATGTCGAACTACTTCATCGCCGCTTCGATGCTATTGTCTCCGGTAGCGCTAGTGACGAGATGGAGCTGCCAGCTGACCCGCAAAC
AGTCCAGATGCACGCGAGAGCCGCCTTCCTTGTGTACACAAAGAGTTCGGTATCTAGCTAGGGCGAAATCAGCATAATGAACAATTTCCAACACAAGCAA
CAACAAACCTGTTGATTTTCAGCACGATATTCTATCTCTTCTTCGTCTCCTTTCCATTCGTACAGAAGTTGCAGTTTATAGTTTCTTGTGCAGCAGAGGT
GTTGACTCGGTCACGTCAATTACCACGTGCTTTTGTTGCAGTCTCCATTCACCACTGAACGGTGGTCTCCAAAGGTTAAGCAGGAGAGAGAAGAGAATGA
CGGGGACTGACGACAGCAGTTCCGACAAACCAGCGAGGGCCGGAGGGATCCAAATCCCGAGCGGGGCGTATAACGCTCCACATGCAATAGGCATCATAAG
CAGGTTGTACATGAATCCCCATGCAAAGTTATGCTTGATCCGGCTGTTAGTGGCTTTCGAAAGCGCACGGGCATTAAGCAGGTCACGCAGGTCATCTTTA
ACCAGCACCACATCGGCAGCGTCAAGCGCTACGTCAGTTCCAGCTCCAAGTGCCACACCGACATCAGCCGTTGCTAGCGCAGGAGCGTCGTTCACACCGT
CCCCAACAAAAGCAACGCGCAGACCCAGACTCTGCAACAAGCGCACCTTGTCAACCTTTTGGTGAGGCAGACTTTCAGCTAGGACAGAGCCATCAGGAAC
TTCCAGTGCCGTTGCCACACTCATGGCCGTGCCACGCTGATCACCGGTAACGATCCACGGCTGAACCCCCTCGCGCTTCAGTTGCTCAATGACATACTTA
GCCTCAAGACGTAATGCATCTCGCAACGCTATCGCAGATACCAACTCGCCATCAATGACGACGAATACCACTATAGAGCCATGTGACTGCAAGCGTCGAT
TCTCTTCGATGAACTCTACAGGAACCCTGAGAGCGCGACAGTCACCATACGTCTGCTGCTTCAGCCAGGTGAGAGAACCAAGACGTACATCAATGCCACC
CACTGTACAGTGAACACCACACCCTGGGACGGCCTCAAATCCTTGCGCTTCCTCGCCCTGAGCATCTTGGATCAAAGTCTCAGCATGCGCCACAAGTGCT
TTACCAATGGAGTGCTCGCTGCCCCTCTCTGCGGCAGCCACGCATCGCCAAAGTTGTGTCTCATTAACATCATTTTGCGGCATAAAGACACTAGCTACCC
CAAGTTGGGCAGTAGTGAGCGTGCCCGTCTTGTCAAATACAACAGCATCCACTTCCTCAAGCGCCTCGAGTGCGCGACCACCCTTGAAGAGTATACCCAC
CTGCGAACCTTTTGTTGTTGCCACCATCACCGCAGTAGGCACGGCAAGACTAATTGCACATGGGCAACTAATGACTAGCACCGTGATCGCAAAGCGCAGT
GCAAACGGGAAAGGAGCCCACCCCTGTGTATCCACATGACCGTGCTTAGCCAGCGAGTACCAAAGCATGAACATGAATCCGGCGAGAATGATGATGAACG
TCGTAAAGTATGCGGCCACAGTATCCGCAATGTTCTGGCGCACACCACGAGAAGCCTGAGCCTCCCCTACCAGTCGCACCATGCGGGCCAGCATCGATTC
GTGAATTGTATGTGTTACCCGCATGGTCAAAACGCCCTGGGAGTTTATGGACCCACCGATCACAATCGCTCCAGGTTCCTTGGGCACCTTACGCGCTTCA
CCTGTCACCATAGATTCATCCACTGAGCTAGCACCTCCGACAACTACACCATCCGTAGGCACTCGAGCACCCGGAAGAACTTTAAGCAGATCGTCACGTT
CCACGAGCACCACGTCAATATACAACTCTTTCTGACCCTCCTCTTCGAGTAAAATAGCAGTCTTGGCCTGCATGCGCAGCAGTGCATCCACGCTGTTTGA
GGCACGCGTTTTTACCAGTGTTTCAATATAGCGGCCGACGAGAATGAGAGTGATGAGCAGTACAGTGACTTGAAAAAAAGTCTCTGTCTTGGCTGGCATT
TCTTGCTCATGTGGTGGGGGAAGAGTCAATCCCGTCGAGGGATCCACTTGAGTCGGCACTGTGTCTAGTGTTTGAACCTTGGTGATTGCCCCAGCAACAA
CAGTAAAAATCGAAAACACGTAGGCTGTGCAAGCACTGAGTGAGATGAGAACGTCCATGGTAACGCGTCCACCATAACGGAGTGCGAGGAAAGCGCTCTC
GTGAATGGGACGCGCCACAACGAATAATACAGGCGTCGCACAAGCCAGTTCAACAACATCTCTCATGCTCAAGCGGTTTGCAGTGCCCCAGACTGCTGCG
TCTGCTGGATTAGCACCGGACGCTGAAAAAAACAGTGGCAGCACAAACTCGACAAAGATTATTGGTAGCGATAGCAAGCAGCTCCATAACAACAACCGTG
TAAAGCGTCGCACTTCTTCCTCACCGGCACGAACCGAAGGTGCCCGGGGACTTGACGCTACAATAGTGAGACCTAGCTCACGTGAGAGTTGGCGCACAAT
TCTACGAGCACCAACAATATCTGGGTTATACTCGACCAGTAGAGCTTTGGACGATGAACTCGAAATGGCGGGCTCATCGGCGTCTTCTACTGAGGCAACA
CCAGAGATTTGTAATGCTAACTTCTTCGCACGTCCAGTGTTTTCAGACTGCCCAAGGTGCAGAACGACACCCACGAGCTCATCACTAGATAGTACACTGG
GCTCAAACCCCAATGTGACCACTGTCTCCTCGATATGTTTCGCTGTCACCAAATCCGGGTCGAACTGAAACACCCCTCGACTCGTAAGCAAACTCACATT
CACGTCCGTAACACCACGCTGCGTGATCATAAACTTCTCAATACGAGTACAACACCCACTGCATGTCATACCAGCGATGTTCAAACGGAGAATATCCAGC
GAATCAGACATTTTCCTCTTTCTTCCTGAACTGTCCAAATGCGACCGTTGCTTCTCGAGGGCAGCCCCACGATCGCTGCGGAATTCCATCAGACGTTTCA
AGAAGCTAGGAGAGCGCTCTGAGAGCGACTGATCCTGCGCTTTTGACGAGCAACATCCCAATCTAGGCGCCTTCTTCTTGTCGCTGGGAGGCGATGAACA
GCAGCCACCGGAGTTTTTGTTGGTGGCAATAGATGAACAACAACCAGACGTTTTAGGCTCCTTTTTGGAGGCACAGCAATCGTCACCTTGGGTCTTTGAC
TTCTTAGAGCAGCAACCCGACGACACCTCCTTATCCTTCGGAGTGCAGCAGTCGTCAGGCTCATTCGCAACTTGTAGGGTCTTCGATGAGCAGCAACCAG
ATCCACCAGCTGCCTGTGCCTTCTTTGACGAACAGCATTTCGATTCTTTCTTGGAAGTACATCCTTCCTCAGCCTCAGCCTTCAGCTTCTTGGTCGAACA
GCAGCTTGATTTCTTGGTCCTCTCCTTAGAACTACAGTCATTAATGTTACTTTCACATTCATCAGCTTTTGACGAGCCATTGGACACTCGAGTAGCATCA
GTTGAGCTGCACTCAATCTTTCCCTTGGAAGAGCAGCCCTTGTCCTGTTTCTTGGACGAACAGCAGCCCGAACTAGTAGGTTCCACCAAGCCGTCAGTAT
CATCAGCATCCTCCAGAGCTTTGGACGAGCAGCAGTCCTTCACAACCTCCTCCTTTGTCGCGTTTACAGCTTCGTCATCGGTAGAGCAGGACTCTTCTCC
ATCGCTCTTGGTACCACAGCAGCCCCCACACGAGGACTCCAACGTCTCTGCAGCTACAGGATCCTCCGACTTGTCGGTCGCGCGACGTCCTTTACGTTTA
CCCATACCTTCCACGCCTTGAGCAATGCAGACGCGAGCTAAAGACGGAAATGAAGAATGAGTGTGCGATCAAGAAGTTGCGATGTTGCGCAACTGAACAG
ACGGAAATGAAGAATGAGTGTCCGAAAGGATGCGATCAGGAAGTTGCGATGTTGCGCAACTGAACAGCACGCAACATCGTTCTCTTAAGTTGCACAGAAA
TGTTGCGGATGAGGAAAGATTGCATGAACATTTCGTAAGCCCTAACCACGGTTCCGGTCCATCTGAACCGTCGATGCATCGATTGAACCGTGTATTTGGT
GTGTGATACCTAAGTCTCTGGTTGGCTGTGGTTGGCTGCATCTTTCGCGAACTCCATTGGGCACTCAGTTCTTTTCAGACAGGTAAGACGCCACCGTCGT
GCTGTGTGTCACTATGTAGCCTAAATCCTGCCTTTATCCACAGGTATATTCATCACCATGCCCGCTTCCAAGACTGCGAACGTCGTCCTCGCCCGTGGCA
TCAACGCCATCTCGCGCAACAGCCTCTCGAAGAAGAATGGCCGTGGCAAGATGATCAAGAAGGGAGGCGAGAAGAAGGTCACTGCCAAGAAGGTGTCTGC
CAAGAAGTGGTACCCGGCCGACTACATCCCGAAGCCGCTTCCTTCGGCTAAGACCAAGCGCAACAGCGTTAAGACTGCCAAGCTGCGCAAGTCGATCACC
CCCGGCACGGTGCTCATCCTCCTGTCGGGCCGCTTCCGTGGCAAGCGCGTTGTGTTCCTCAAGCAGCTGGCTTCGGGTCTGCTGCTCGTCACTGGTGAGT
TTTCTTTACGATGCGACTGGAGCAGGCATTCCGATGATGCAAACTTGACACTTGAGAGGCGCATTGCCGTCTCCACTTACGTCTGTCCATATAACTACGG
TCTCGTATCTCAGTCTGCTACGTATCCATTCTCTCTGTTGGGGAAACTTAATCGATGGAGTGGTACAACTATCGGGCTGAGGCATGCGGGTGCTGATGGA
AGTATGTGATGGATAAAGAGGGGCTGACTTTTTGCCAAAGATCCATCAGATTATGAGACCTGAGGAATGCCAGCTCTGGGATAGTTGCTGCTGTGACGAG
ATTTGCTGACAGGTTATGGTATCCTTTGTTACAGGCCCGTACAAGGTCAACGGCGTGCCGCTCCGTCGCGTGAACCAGTCGTACGTGATTGCCACGTCGA
CCAAGGTGAACATTGAGGGCCTGGCTCTCCCTGCCATCGACGACGCCTACTTCGCCAAGGAGAAGGCTGCCAAGAAGAGCAAGGAGGAGCAGTTCTTCGC
CCAGTCGAGCGTCGTAAGTTGCTATTTTATACTGTGATATCCCTTGTGAGCATCTCGTTCCGGTTGGTCGGGTCTTCAAGACCGCTACAAACGATCTGTT
CACATTCAGCAATGAGGTAGTCAAGCAACGGGAGAATGAGATTGACGAACCCTTATGGGATCTCTCTTGTTCTTCAAATGCTTGCTACTTTTTGCGTGGC
AGATCAGGCAGGGAGTTGAATTGCTCCCTGCCACACCACATGAGCGCTTGGGATCGCTTGCTTCGGCACTTAAGCTCCCTACTAAGATACTGACCGTGTT
GTCTTTATTTATTCAGGCCCCCGTCATCCCGGAGCAGCGCAAGAAGGACCAGAAGGCCGTGGACTCGGCTCTGATCAAGAAGCTCGACGCCGAGCCGTTC
CTCAAGGCCTACCTGAACGCCAAGTTCACGCTGACCAAGAACGACCGCGCCCACGCCCTCAAGTTCTAAGTGCCTTTTTGCTATCCTGTGTAGCAGCATG
ATGTGCGAGGGATTGAGATGAGAAGAACAATATACCTGATGAAATTATCACCACATTTGATATTTTACTTTAACCTAGAATCTCATCGAGTAGGTCTTGC
AGTAGAGTGCTATCACTTGTTAGAGCGTCGTCGTCGTCATTGACTTCCTCTTTTCTTGTAGAATAGAGATTGCCATCACCTTCGTGCACGAGTGCGTTGT
AGCTGGAGCTCTTCTTCACTGAGCTTCGTTTGAATGAGCCTCCATTACTTTGAATTGATGCAACAGCTTTCACATCTGCCAAATCATCATAACCAGAGCG
AGCACTGACAAGTGAAGAGCCCCATTCCTGGTGCCGAGTGTGCGTCTGGTCTCTCTTGGCAGTCCATGAATGATGATCTTGTCGTGATGATAATCCACCA
CCTCCAGCCCAATCCACAGCACATACAGCGATATCGTCCGCCTTTTTCGCATACACACTGGATCGCCCTGTGTAGCTTGAGTATCCCCCAACAGACTTGT
ATGCACTTCGAAGTGGCAATACAGGCACTTCTTCCTCAGGTGTCACCAAGGGAAGAATTGATAGTGTCGGTCGTGCCACAGCTTGATAAAAAAAGCGGTG
TTGAAGTGCCTGCGCCGCTGTAATGCGTCGGCTTGGATCGTATTGCAATAAATCTTGCACGAGCCGTACAGCAGCAGATGGCGTACCTGGTGGAAGAAAT
CGTTTCCACGATACAGGAGCACACTTGGGGAACCGCATGTGCAAATGAGATGCCGTTGCTGCACCCTCGGGCCACATCTCCTTGGTGGGTGTACCAAGCA
CCTTGCAGATGCGGTAGAATTGATCTGCCTCTGACGTACCAGGAAACAGCGGCGTGCATATAAGCAGCTCTACCAAGATACATCCACAGGCCCACAAGTC
AATGGGGCTGTTGTACGTCGTTGAACGAAGTAGCAGCTCTGGCGCTCGATACCATCGCGTTGAGACGTAATCCGTGAACGGCGGTCGTGACCGAATTTCA
CGAGCCTGACCCAAGTCTGCGATCTTGAGGGTGTCATCATTGCACAACAAGTTCTCGGGCTTGATGTCACGATGAAAGTAGCCGTGCTTGTGCATGTAGG
CCAAACCGCTAAAGAGCTGAAACATAATCGATCGTATCTGTGCCTCCGAGAACCATGGATGCGGGGGTGTTGAAGTCCACGATGAAGTGGACGTGTCGGA
ACCTGAATTTGTATCAGCCGCACCAGAAGAGTTACTACCTCCTCCACTTTTGAGGCTTCGCATGACTCTGAAAAGTGACGTCTGCATGTACTCGAACACG
AAATAAAGCTCCTCCTTATCTCGAATGACTTCTTTCAACACCACAATGTTGTCATGGCGTAGTACTCGCAATGACTTGAGTTCACGCAACTGAAGACACT
CCTCCCAAGTAGGAAATATTGCTTTGATTTTCTTCACAGCCACAATTTCGTGAGTCTTAAGACTACGAGCGCGTGTAACTTCGCCGAAAGCACCATCACC
AACTCGGTCCAGCATCTCATAGCGATTCATGCTATGCTTGAACTAAGATTGCGTGTAGCTCTTTGCCTTGATGCTGCTAACTCTTGCCCAAAAGCAGGAC
CGCGCCTTATTAATAACCAAAAGAAACCAGCAAAAAACAACAAAAATGACAATAACTGTTAGAAAGGGAATCCTTCATGTTGGTGAAGATACGACCAACG
CGGCTAATACTCGTTCTATGACGATTTTGTTAGCTTGCTGTAGCTCTCGATCATCCAGCGAAGTGTCCGTGCTACCGTATCAATGTCGACCTTGTGAAGT
GCACTGAATACACAAAACAACTTTAGTTCGTGCTCTAGGACTGGTCGAGGCGAACTTGAATAGAGTTTTACCTGACGGGAAGAACAGCTAGCTCGGTGGA
TTTGCACAGCTTGTGAAAGTTGTCTTCAGCACCTACATAAGATAATGTTATTTAATGCAAACAGCGTAGAAAATGTTATTCTAGAATCTTTACCTTGCTC
ATCCATTTTATTGGCAACGATAAGGGACGGCCGCGATGAGATGCCCGGGGCATACAACTCCAACTCTCTTTGGAGATGTGTGAAGTCCTCCAGAGGATCA
CGTCCCTCAGAACCCGCTGTATCAAGAACGTACATCAAGATCTGTGCATCCACAAGCAGCAAACAAACCCACATGTAAGTACCATCGTCAGTATGCAAGG
GAACCCAGCTTCGTATTTTTGACCTTTGTGCGCTCAATGTGGCGCAAGAAATCGTGACCAAGACCGACATTACGGTGTGCGCCGTCGATAAGTCCAGGAA
TGTCAGCCACACTCAACCGAAATGTATCTGGAAACTCCACAATACCCACGTACGGATGCAGCGTCGTAAACGGGTAAGGAGCAATCTCTGGCGTGGCACG
ACTTAGCACACTCAGCAAAGTCGATTTGCCAGCATTGGGGTAGCCCACAAGACCCACATCAGCAATTGTCTTGAGTTCCAACTCGTAGTACTGCGATGTA
CCAGGTGAACCTGTAGTCTTGTTCTCGGGCATGTGTTTGCGCAGTCGACCAAACTTGGTCGTCTTACCCGCCAGAATCCGATTGCCCAATCCAGGTTTGC
CACCCTTGGCAGCCAAGAACGAAGCTCCAGGTTTATCGAGATCAGCGACGACTTCCATCTGATCTACAATTTCGTACTCGCCATTCTCCAGCTCGCGCTC
GTAGCGTTCCACACGCTTGACAAGCGTTCCACACGGGACCTTAACATGGCAATGTTTGCCTCTCCTACCTGCAGCATCGTTCGCTACAACAAGCCATAAA
CCCAATTAGTACACCTCCAAATGCACCACCATTTACTACGTACGCATGCCGTTCGTCCCTGCTCCTCCCTTGAAATGGTGCGTAGCATTTGCCAAGTTCT
GCATCTTGTCGCTGGCCTCAATCACCACGTCACCTCCAGCACCCCCATGTCCGCCATTTGGACGTTTGCGCATAGCCGACTCGGAGAAGAAGCTGGCGCA
TCCATTGCCTCCGTGGCCACCAGTGGCTTTGACGCGGATGCGATCTACAAAGCGACGCTTCGAGTGCTGCGCACGACGGACGCTCACTTTCTTCTTGACG
TGCTCTTCCACCTTGCGACGTCCAGCAGAAGCCACGTCTCCATCGTCTTCCAGGGCCCAATCGTCATCAAGGTCGTCGAGGTCGTCCCAGTTCAGCTCCA
AGTCCTCCAGTTCCAGATCGTCGTCTTCATCGCCACTATTTTGCGCACTAAATGCTCGGATCGATGAGCGATTGAGGATTGAACGACGCAGTGGCACCGT
GGTTAAGCCTCGAAGCAGCGTGGACACACGCAACATTGCTTTTCAATCTGTTGGTTTTGTTGCCTTAGTCTCACTTAAGTACGAGTTGCATGATAATTGT
ACTGCAAAAAGGAAAAGATGGCGGATGGAGACGATTTCAACCGTTTGTATGCTTTTGCACTGCAAACTTTGCAACTGTATTGATGTATACTCATGTGAAT
CTTTTGCATCAGGTACGAGCGATTGGTGATGCGACGTACGAGCAAGAAGAAGCAAGTGAAACGAGTTGCCATTGACAAGAAAGATGCTAAAGCTATTGAT
GCTGCGAAACTGGAGGAGAGCAAAAGACAAGCGCAACAGAAACACGATGCAAATATCTTGAAGGCAGTGAAGAGATTGCGTCTCGCCAGGAACTTACGTG
GTTTCTCACGATTGAGTCGTTGTAGTCCCCATCGCCTTGCATATCAACTTGCTGATGCAAATGAACAGGACGAATGCCGCTTGTTGCAGAAATATGAACG
AATTAAACGACGTTCTGGGTTCGTACAACGACACGCTTCAGACTCGGAGAAAATCGCAAGACTGGAAGGAGTTACTGCCAGGTATTGCCACCCTTTGCTA
CTTAGGTTCATGCATACTAATACGTATGATCTGACGGCGGTTTAGACTGTTTCTCCAACGAGCCGCTGCCTTTCGACCTGATGCCACAACGACACTAGAG
GGGAGGCATCGAGTAATTGATGAACTGCTGTTCTTCTCGCCACCAAACTTGAGGTTTCTATCGCGAATTGGCTACGCTGATAGAGGAAATGTGGTGCCTC
ATCCAGGTATCCAAGTGAACAAATGACGCGAAGGCCTGAAGTAGGTTCATACATTTGTGTACTTGTGAAAATTCAGCTATGGTCTAACCTTACACTCACA
TACTTATGTTACACTTGTGATAGAGCTACGACTCATGAGCAACCGAGTCTCGGTAGCCCCAGCATACCCATCTTTAGAGAAGGCAAAACCATGATATGCT
TTCTGTAGCGTTGTCCTATGCTGCTGGGGTCGACCGTTTGTTGGAATAACGGAGCTAGTCTTCTTGGCAGATCTTTTTGTATGTGGAAGACGGGCTGGTA
CCGCCACCGATGCATTACTGTTGTCATTCCAGTGCAGAAGTTTTCGGTCAAGGTTGAATTTGGTGACCTCTTTGGCGAGGTGCCAATATTCTGGAAAGAA
TGTCGATCGAACGCCGTTGAGTAGATGTGCATACGAGAGTGCTGCCACCGGGACGAATAAATAGATAAGCCAGAATGATGCCAATCCAAAAGATTGCTCT
AACATGAACTCCCACGTGAGATCCGAGAGGAAGTAAACGTGACTGCACACGAAAGCGACTACGAGCCACACCAGCACTGATCCGAGGTAGAGGAAGTAGT
TAAAGAAGTAGAAACTATTCTGGAACATGAACAGCTTTGAATTGGCAATAGAGACGACGAGGGTGAAGACGATGAAACCCTCCATCCACATCGTTGGACT
TGCTCCACCAAACCCTGCCTTCTGTAAGCCATGAAGAGTGATGAAAGTGATAATGACACTTTCGATGATCGCACCTACGACCCACAGCGAAAATATACGG
GTATTGATGTCTTCATCCCGAGGTCCCGTGAAGTAGAGTTTGGGATATGTCATGGCTACTTCGTCGTTTACGTCTTGATCCAAGATAGAGGCTGCAACGA
TCGGGATTGCCGTTAGCGCGATGTTGTACAGTTGGGTGCCGCTCTCCAGGAAAAACTTTTGCCCGGAGAAGCCACACAAGAGCGTATACCAGTATTGAGC
AGCCGTGAAGAGGATATTCTTGTAGAACATGTATAACACCAGTTGTGCCATACGTCGGTAGTTCCATCGGCCGTGGACAAGCAGCAAGCGTTGCAAGTAA
CGAAATTGAGCAATGGCGTAGTCGCTTGAATTTACCGCCTGCATACCTTCTTGGCCAGAAATTCCGACACCAACATGAGCTTCTTGAATCATAGATACAT
CGTTTGCTCCATCTCCGATAGCAAGGGTACGAACCCCAGGGACATACTCCTTGATTAGGGCAACCATCTCGGCTTTTTGAGCTGGGGATACTCGACACGC
GATAACGGCTTTGCAGAATTGAGAAAACTCGGCAAGCAGGGGACGGCACGAGCCGCGTAGAGCATACATAAGCGTCTCGCCGTCAATAACAAGAGCTAAC
TCTCGGAGCTCCCCTCTGGTACTTGGTGGCGAAGCGAGATACACTGTGACATCTGCGCTGCGAACTCCAATTTCGTCTCGCAAGGTGTTTTCAAGCACTT
CAGCAGTTGGTGCGTTCTTCGCATTGATGATGAAAAGCTTCATATCATTCGTGACGAGCTGACAAGCAAAGCCGATGTTGATAGCAGTTTCTTCCTTGTC
GCCCGTAAGTACCCAGATTTTGATACCTGCACACGCCAAATTGGCGATCGCGTCCGGAACACCAGATTGCAGCTTGTCTTCAATTGCAGTCGCTCCAAGA
AGCTCCAAGTCTTGCTCGATCTCATTCATGCATTCGTCAATCGCATTCGGGAGGTCCTTTTTGCGTTTGTCAATTTCATTCAGATTATTTTGCGCATCGT
GGAAGCGTGTCGACCACTCTGCGTAATATGAAGGCTCAATCTCGCGAACAGCAATGGTGAGGGTTCGAAGTCCATCCTCAGCGTACTGGTCGATGTGACG
TCGAGTAATTTCCTGGAGTTGCGAGGAGGTTGATTCGTCCTCTTTGTCCTTTATCAACAAACCGTAGATGATTACGTCTGCACCTTTCGAGTACAAAAAG
ATTCTGCCATTGGGGTGGCGAATAATCGTGCTCATGCGCTTTCGTGTACTGTTGAATTCAAGCACGTCAAGCATCTCATATTTTTGAACCGTGCCACGAA
CTTTGACGTGTGCGATTCCAGGAGATCGATTCACAAACTCGTAACCAAAGTACCCTGCGCCAGCAACCAGTGCCTGTTCATCAGGTGATGAAGCCGAAAG
AGTGACTTCTGATGAATTTTCGTGCCGTTCTGGGATGACGGTATGGCACACTGCAAGGTGTGTGAAGAAGGCATCTATACGTCCCTTTTGAGCGGACCCC
GCGTCCCCCTTCATGTCGTTAAATAACTCTGGACCATCGAAGTTTACATATGGAACTTTTGGTCCCTTTGACTGCGAAGCCATATCTGGAAGAGGTTTTC
CTGCACGTCTTAATGCAGCCAATCCAATTTCCGTAGTTCCGTTGCCATACGAAACACCGCCAATCGAACATTTCCGGAACTCCATGACATTACACGTGAG
AGTACCTGTTTTGTCGGAGAAGATATACGAAATCTGCCCGAGCTCTTCGTTAAGTGACATGGAGCGAACAAGCGTGGGTGTATCTGTGTCTGGATGGTAT
ATGCTGATATCCCATTGAATGAACTGTGCTTGGAGATATTTGACCATACTCATGGAGACGGCTAATGAAATAGGCACAAACTGGTACATGAGTAGCAGGT
AGTAAAACAACATAATCAGCCAGTCCACGAAAACGCTGTTGTCGGATGTGGTCAACTTGAGATACCACAAGGAGTCATGATCCGATTTCCAGCCTACCGC
TCCAGTTGCACCAACAGCGCTGAATATGACAAGAATCGCCAGCAACACAACTGTGTACTGGTTGATAGACCGGTCCATCGAGCTCATTTTAGATGGAGGT
GCCGAGTTACTCATCATAATCTTCGTGTCCTTGCCGGTGTTGAACACAATACCGTGAATCCACTCCGTGTTGCGAATGATACAACCACGTAGAATAATAC
TTTCGTATGGAATCGAAGCCTTCTCTTTTCCGTCAAGTTCCAACACACCCTGAAAACTGTTAATCGCATTATTAGGGTGCTCACAACGGATAACACCTTT
CATCCTGACCAAATTGTCGACGGATCCCATGTCTGCAAGTGTACACTCCATCGCGGAGCGAACTTTCATATTGGTTTCTCCATCCAAAGACTTTGTTTCG
ACATAACAAATACCACACGGTGGTTGATTCGGGATTTCACTCACCGCCAGCACAAGCATATCGGCCGGTATCTGGCCACGGTTTGTAACTTTGACCACAT
CACCTACTACGACATCTGCCCACGTCGTTTGCTTAAATTTCCTTGTTTCGCGGTCAAGAACAAGTGTCGGACTTGCATTCGCAATGTTGTCGGCTTGGTG
ACGCTTGTGATCTTCGAGAACGGCAAATACACCATCAACCGTGATGATAAACAGCAAAGGTGGCAACGTTGACGGTTGACCATTGGTATTGCTGATGTCC
GGGATGCACTGCAAGATACAGATGATGAGGAAGTACAGGTTGGAGAGTTTGCGAAAGCTTTCGAAGAGAAACTTGGGCAGAAAACTTGCAATTGTGTACT
TGGATGTGACAATGAAGTTGTTGCAGTAGCCGGCTTCAGTGTTGCGGTGTGCATCGTTTAAGTAAACCACGCGGAAGTCTCCAGTGTGCCCCGCCGTTCC
TTCGCCCATGGCTCACTCCGTCACACACAGCCACAACCAGAGACAGGAAGATGAGAGCTAGTGCCCAGTGGTGGTGGAACTGGGCAACGAGTAAGCGAGA
AGACTAGAATGAACCACACTAACCGTCCACGGCTTTGAATAGACCACCACCAGCAAACATGGAAGACGAGTTGGAAGGGGTTTCGCTTTGCATCTGTTAT
TTTTGCGATGATGTGTCAAAGCAAAAGTATTCACCACTAGACCGTATTCGACATTCTGCTATGACGATGCTCTTGGAATTGCTTTGAGATTCATCTAAAG
CGACAGGGTCAGGTGCCTGCATTGCCAATCTTGCAATCGCCACTTCAATCTGTCAAACCAAGGGATTATGCGATCATCATTGTCCTTTGTCTCAACAATG
CATACTTTAGTTAATCAAGAAAATGTAGCATCATCAGTGCTGGTCGAATAGTTCGTGATCACTTCACTTGGAGTGATGGTCACTTCAACTTCGGATTCCT
CTCTCACTTTCGAATTTGCCGACTTGAACGCAAGCCGATGAAGACCCAGCGCGGACGCCGACGAAAATTACGTTTCAACTCAACAAAAGACGCAGTTGCA
GTGGTGACCGTTAAGGTGGAGTGCGCTCCGAATCAACCGAGAGAGCGGCGCAAACGCCAGCAACATCCACGTCGCGTCAACCCCGTGCCATCACATCCTA
GTAGGATCAAGACCCACGTGAATGGCCTCCCAACGGCGACATGGAATGGTATCCAAGCACAATTCGCAGCGGCTAAGAGTTTGGGTGAAATGTACTTCCC
AACAACTAAAAAGAAGCAAGCGCAATGTACTAACGTGGTTTGTGGCATACCAGAACGCGCACTATGTTGCAGTTTTTCAAGGAGCACGAGATTTTGCAAG
GCTCTGCATCCGGCCCTGCGTTCCCGCTCTTCGTCCCATCTAGCGACATCTACAAGATGAAGGGTATGGCATGCATTTGCATTGTTCTCATACCATGGTG
CTAATTGTTGCGTAGTACTGAGGAAGAGACGGATCTACGATGTCTTGCACGTTCTGGAAGGTATGACACCTGCAATTTCTGCTTAGCGCGACGGAGGTCC
AAACATGTGTGACTATAGGGATTGGAGTGATCAAGCGAGTTCGCTGTAACGATACTCAAAAGGCCAAAGCAGGCTTTTTGTACAATGGGAAGGCTGCCGT
CGTGCAGCACCTAGCGGAGATGCAGCGCAACGCGGCACGTGTGATGGTGAATTTTCGTCAATCTCGAGGTTTAAGCCCGGTCAGTATTGTGGAGGAAGAC
GGCGCTATCGTCAAAGTTGTGGAAGACCTGGCGACAACTGAGAAATGGCCGTGCTTAGTCAATACGACAATTTGCTTTCTTGGTTTGTTGTTCCAACAAG
ATTATCAAGTTGGGGTGGCGCTGCCGAATATGAGCGCTCGTCTTATTGAAGCGAAGAAATTCATTGGTGCTTTAGTGCCGTTGATGTGGAACGAAGCTTC
GTGTAAGGATGTCCATCGCCGGGTATACGATGTCGCGTCTGTACTAGAGAGCTGTAGCTTGATTTTCACCTCGGCCACAGCACCAACGTCTCTCAAGTCT
TCTTTCAACAAAAGGAATCCTCGAAAAAGTGTGAGATTCAATTACGACATTTTCACAGATCCAAGTGTACTCTTTGCAGCTCGCTCTTCCGATGCAATGT
GGAACACGTCAAGTCAAGAAAATGAACTTGAAAGCACGAATGCATTCTTCGGTGCTGTTTGCAAGACCCCAAAGTTGAGAGCTCGGGAAGATCACCTGGT
ATCTCCACCATGGCATAGAATGCATACTGTCACGACCATGACCAGCTCACCAATATTTCCACAGGCTGATCCTCGATTATCCGATACTTGTACCTGTGAG
AAAACGAGGTGGAAATCACCGCCATTCAACGAAACGAAGACAACGGCAATTGATACAAGCTGGAACGTGCAGCCGAAATACCGTCCCGAACCATTACCAA
GCTTCTGTGTCCGTGCTTTTTTCTCTCCTCTTGGCAAGGAACCGACAGAGAAGAATGAATGGGATGACGAGTCTCTGAAACTACTTGGCCAATATGATGC
TCCTCCTGTTCAAGAGAAAATTGACTGGTACCTGAACAAGCACTACAAAGAAACTTTCCATGAAGAATGGGGACAATGCCCCGGTGCAAACGCATGTTTC
GCATCCATCGAAGTACCACCGGACCAAGTTTGGGCTGACAGTGTGCAAACAATTGGGTACCATGAAGTTCTGGTTGACGATTGCGCTAAAACAACAGCTA
ACTTTTTGTGTTGATCAAGCGCATACCTTGGTTGGATACGTATATGCATAATTTCACCTTCTACAAGTTGAGTCTTCATTATATTTGTGTCCTCACTACC
CCGACGTTACCTCAAATCCACAAACCGCTGCTACTTAAGGGAATGTCTGTGACACCTGAGCAACTCAAAAAGCCACTCGAGATGCTGTCACCGTCATCAT
CATCCCAGTCATCGTCTTCCCAGGCTTCGCTCTCGCTCTTACTATCGTCTTCGTCTTGGGTGTCCAAACCGCTGGCTCTACGTACAATTTTGTTGGCCTT
CTTCTCTGCGGCGTGAGACTCAAGTATCAACGACTCGGCACGGTTGCGTGCTAGTGCCGCAGCAATTTGACTCGCTGCAAACGCAGGTACATTGTTTGAA
TCCAGGCCAACCGTCTCCAAGTGCATGTTGACGTCCAGTGCATCCAAAAGTTCCTGAGCTCCGACTTGCGTGATCTGGTTATGAACGAGTTCTAGAGACT
TGAGAGTGCAGTTACAACGGATGGCTTGGGCTAAAGCCTTAGCTCCACGATCAGTTATCAGGTTACTCTTTAGACACAACTGCGTCAGTGAGTCATGGCC
ATACAATGCCTGTGCCAATGCTTCAGCCCCTCGGTCACCGATACCATTCCCGTACAAGTCCAGGTATTCTAGAGTTGTGTTGTTGCATAACATTTTCGAG
AGAGCAATGGCACCATCATCTCCGATAGCATGGTCTCGAATAATGAGAGTCCGAACGGTGCGATTAGTTGACAGAGATCGTGCCACAAGAGCACATCCTT
CAGATTCCAATCTCTTGTTGTGTTGTGCGAGAGTTGAAAAGTCCAATTCTCTCACATCTCCGTCGTTGAGATGGATCCGCTGCAAGATAGAACCTAGTGT
CGGGCCTGTGCGTAAGACGTGAACAACATGGTGAGTCAACAAATCTGTTACGGTCCGCAAAAGAATAGCTTTACTGACCTTGAACTCGCGAAATGTGCTT
CGTCTGTGGCATATTTTTCGGCAGTGGTGGCTTACCGACACCGACGTTTGCTCTTGCTGCGGATGTAGGTGGCTCAGTGAAAACAGAACTCACCGATGAC
GAAGTTCCGGTTGTACTTGTCGACGACGGTGCTTGCTCCGATTCCGACTTCAAATGTTCGTCAGCGTCTTCGAAGACTGCAGGTTGATTGCACTCTGGTT
CACCAACAGCCGTAGCATCTTCGATAGCAGGCCCTTGATTCAGTATTCCATGCTGTTTTTCATTCTTCTCTTTGAAATCGCCATCAGTCTCAGTCTCCTG
ATTGCAACTTGAGCTGTTCACCACAACAGCAGATCTGCAATCAAGTCCGATGGCGAGTTTACCGTCAGAGTCACAGACAACCTCGTTGACGCCAGAAGCG
GGGTCCTCCATTTTCGGCTGGAACTCTAGATTTTGAATTCGTGGGACGTCAACAGACTTGATTCCAGTGACACTGACAGTGGAGTTGGCATTCTCTGGAG
CTGCTTGATTGGCTTTGGCCTGGTTAACGGACTTGGATCGAAATATCAAACGTCTGCGCTCTCCTGGTCTGCCTCCGCCAAGCAATTGGCGCCAGTAGCG
CTGGGAACGATAATAGCAGCACCCAACGCGATGAAGGATAAGAATATGAACGTCAAATTCTAAACTCGATAGATGAAACGTGAATTCTACAAACCTCGAG
GTGGTGCTTTGCGCGACGGAGGTTGATGTCGGGCATCAGCAATGCCATCGACACCGACTTAACGACACTGCTGCGCTGCTTTCTCGCTCTCTTGACACCC
TTGCTTCGAATTCCGCCCTGTAACAAGCAAAGCACGCACTAGACTCCGATGGGGATGATGCCTGAAGCCACACAGAAGTATTCATGTCGCCCCGTGACTC
ACGACGAAAGCGTGCCATCCATCTGGCTGATGGACCAACACTGCACATCAATGAATGTCCTCTCCCGCCATCGATAGACCTGGTATAACCGTGCAGAGAT
GTCAATGCAAGAACACTAGCAACAACTGTGGTAAACTACTCAACGTCTTCACATTTGAAAGAGAAACTTGTTCTTGCCTTTCGCTACAGATATACGCCTT
GCGGCGTTTACTTAAAAACTGTTGTCCTCTTGCTGCGGCCTTGAGTTTCCAGAGAACGCAGCGAGGTTTAGAGCTGCACCCGACGGCATGCATTTTACCT
CTTGCGGCTCTTGTTGATCTCGAGGATGATGGCCTGCAGCTCGATGCATTGCTCGCGCATTAGTTCCAGATCGTACTTCAGGTTGCGGTTCTCGATCTTG
AGCATCGAATTCTCATCCTCCAGCGAGATGCCGCTCGAGCTCGACGTACTGCCGCTGCCACTGCGAGGCTTCATGAAGCTCTTCGCACGAGCCGACAGCT
CGTTCAGACGCTTCACACTGCCGCGACGACCTGAGTGAGCAACCTTGAACGACTCCATACGGTCAGCGATTGACCTGCCGCGTCCTGCACGAACCGCGGC
CGGGTCATCGCCAAAACCTTCGTCGGCGTCCGAGTCGTCGAGGTCATCCAGATCGTCGACCCACTGACCTCCGCCGTTGTACTCATCCGAATTGTTGTAC
TCGGGCTCAACGGGGACAGCTTTATACCTCTTCCAGCCACGCTGAATCTTGATGATCGCACGGCGCTGAAAGTGATACTCTTTGTAGTCCAACGACATCC
GCGAATACGATTGCAGCACAATGGCGGCGCGAATCTTGTTACGCAGACGACGTCGCTCCAGGAAACCGAGAGCGATACGCTGGATCGTGCGTGCCTCGTA
GTACATGAAATCGGACTTCATGGCCTCCAGCTCTTCCATGACACCATTTTTGAAGTAGATCAGTGTCTTTCCCATTTGGTACTCCAGCGGCGACTTCCGA
CCGATTGACGTCATGAAGACGCTGCATGTGCGGCGAACATCCTTGCTGTGCATGGACGGAGGGAACATAATGGCATAGCGCGTGGCCAACTCCTTCGGAG
TGAGCCGACTCGGGTAACCAGAGCGCGTGATACGGATGGCTTCAACCACACCGGCCGATCGCAACTGCTCCACGATCATACGCTTGTTGAACTCTGTCGG
GCTTTTGTTTGAGTTCGGCTTGATGCAACGCACGTAGTGCGTGTTGGTGGTTCTAATGTTTTCCATTAGCTGAGCCAGGGATGTCTTGAACTGCGTTCCA
AGACTCTTTGGCGCTTTCTTACCACGACCACTGCCACCCTCCGTTGTCGCCTCGGCGTCTTCAAAGAGCTCCGGAAGCAACGATAGACTACTAAGCTGGA
TCAAGTCAAGAAGGTCCTTCTGCAATGTGTCGCGATGCTTCTCCATAAAACCCACCGTCTCGTATGTGACGGAACCTGCATAGTGGTTGATGATGAACTG
CGTGCGCTTCACCTTGGGAAAGTCAATACTCTCGTTCACTTTGCCGTCCTTCATCGTCTGGTGATTCGTTCGGATTTTGTTAACCAGAGCCTCTTCAGTG
TCACGCGGTTGACGAAGGTGGTCGTTCATCAAGGCGATAATACCCAGCTTACCCTCGATCACATCGACAATGCCCACATTGTCCTGATATTGAATATGAT
CAAATTGCAATCCTTCGCGAATGTACTCGTCCTCAACAGTCTTGAACACATCGGTAGTGAACTTCTGCTGCAACTTCTCGTTTGCATAGTTAATGCAGAA
CTGCTCAAAGCCGTTGTGGACGAAGTCCTCAAAGCCGAAAATATCCAACACACCAATCTGGCCCTTGATGCGGCTCTCGTCTGTGCTGATAGCAGCGTTG
ATTTTTACGACCATCCAGTCAAACATCTTGGAGTAGATGGTTTTAGCCAGTGCATCACGGTTCTCCGCTGCTTCTACAGGTGCCAGCGGCACTGTCACAC
TATCATTGCGCGTGATGACAGTGCGGTTGCACAATGCTTCCTCGATTCTTGTCGTTGGAAGACCGAACATCTTGGCTACCTGCGACAGAGCTGAACCACT
CGAAATGCGAGATCCATTCTCACCACTCTTGTCAAACATCACCTCACCAAGCAGCAGCACACCAGCAAGAATCTTGAAAAGCGTCTTTTGTGCGCCGGTG
TCCAGACCAATTATGGACAGCGATTTTTGTGTGCCTGCAAACCACTTTGCATCGTCTAAACCAGGGATCTGCATCTCCGCGAGTGAGCCAGCGTATTGGT
ACTGGCAGTCAGGGTCCAGCCCAAACTCCTTACGTTCGTTACTGGGTAGACCAGCCAGAAGCTGATAGAAGATGTGGTAGTTGCGTTCACCATCAGCAAT
AGATACCACACGCGACTTCTCCAGCAAGTACGTCTCGCACTTGGCACCGATCAACTTGCCACGGTTGTCAAACTGAAGCTGCGTAAACTTACCAAAACGC
GAACTGTTGTCATTACGTGTCGTCTTGGCATTACCGAAAGATTCGAGAAGCGGGTTCACGTCAATGACCTTGGCAATAGTCTTATCCATGCGGCCACCAG
CCACGCTGGCCAAGTGATTCATCACAATTTTCGTCGTTTCTGTTTTACCAGCACCAGACTCGCCACTCACCAAAATACTCTGATTCATCTCGTTGGTCTT
CATGTGATTGTAGGCCGCTGTCGATGTGGAGTATACGTGAGGAGGCAGTGAGTCACGTGGTTTCCTCAGGTACTGTTCATGCAGGTGATCACCGTAGAGG
TTGTCGATCCACTTGTACGGGTTTAGTGCGATCACAATGTCGTTAGTGTACGTGTAAGGTTTTGACGCAGCAAAGCGCTGTTTCAAGTTGAACAGAATCG
AAGGCTCATTCAAGTATCGGAGCAGACGCATATCTTCCACACCCTCCGGATTGTCGTGAAGGATTGCAACTGGGAGCGACTCCACCTCGGTAGCCGTCGG
TCCAGCAACCGCTCGAATGATGTCTGGGTTCTTGAGATCAACGACACGCTGCTCTGAATCGCCCGAGTCCAGGAAAGCTGTGATGGTCACCTCTTTTCGA
CGGTCATTGTAGTCCATGATTTCGGAAAGCAGCCATACTTCCTCCTTGTCAGGAATATAGCACTGAACGCCGGGTACAATCAAGTTCAGCTTGTTTCCAG
CGCCTGCGGCCTGCTGACGAAGTTGTTCCTCCTTAATCTCAAGCTGTTCGTTCATGAAAGCTTTTCGCTTCTTCTCCAAGCTGAAGTTATTGCGTCGACG
TTTAGGAGGCACCCAGTACGTTTGGCGCTTGCGGATGTAGTTACCGCGGCCTGTGGAGCGCTCAATCATGTGTCGCGGCTTGAACGACGTTGGTGTGGTT
GCATGACTCGGTGCATTGAACGCAGGCTTCGGGGCTGATCGACCGCCAGCAGGGGAGTTCTTCATCGGGTTAAACGAAGCAAACGTCGGTTTCGGCGGAG
CAGCCGACGGTGTTGCTGCAATCGATGGAATCGAGTTTGTCGTAGCTAGGAATGCTGCCAGCTTGCTCTGGGAGCGAGGCTTCGTCGAGGAAGCGGGCGA
CGCTGATGGTTGTTGCTGCATAAAGCTGTTGAGTTTATTGGCGCCTCCCGTATTAACGGATGGCTTCGATGGAGCGGGGGCTGGCATATCCGGCTTCGGG
CTGCTGTTACCTTGAGCGAAGACAGCCTTGCGCTGCGCAAACTGCTCGCTTGAGGTGCCGCGACCTCGGACAGGAGCAGACTTCGGAGGAGAAGGAGGTT
TATTGCCCGCAGTGGGAGAGGCCGATGACTTGCCACCTGGGGCGGAATCATGTGTTGACTCTACAGCAGGCGGGTTGGATTTCATGAAGGCCGCGAATTT
GTTCCGGGCATCCCCACCTGTCGGCTGAGACTTTGGGGGTTGTTTGGGCGACGGTGGTCTCCTTACCGTCGGTTGTGGCTTGGGTGCCGGCTTGGGTGCC
GGTGGCTTCCTCACTGAGTTGGTCTTCTTTGGTGGACCTGACGGGCGTTCAATATGCGTCAACGGAGATCCATGCGCCGCTGGTACTTGGCTTAAGAAGG
CGTTCAACCTGTTCGAGTTTGCACCTCCACTGTTGCTCCTCACATCCTTTTGAGGTGGTGGTGCCAACGGCGTCGTAGGGGGTGAACCGGATGGCGACAT
CACTCCCCCTCCGACCTGAGGTGACACTGGCGGAGGCGTCGACGGTGGTGTACCGTCTGGCGATTTGTCCACGACCTTCTTACTCGATTTCTTCTTCCTC
GATAGGAATCCGCCCTTCATGAAGCTCGTGAGTTTATTATTGCTGTTGGTCTTCTTGACTGGCGATGTGCCTTGTGAGCTTCCAGTAGACGCCATCGACT
CTGCATCTGAAACAGGGTCCTCCTCATACTCGCCCGTGTACCCAATGGTGCCGAACCTGTCAAAGAGGATAGAGAGTGTCTCGAGGACTGTCGTAAAGTC
TGCACCGGCATCTAACAAGTCGTCAGGCTGGAAGATTTCTCCCTCATTCAGTCCCTGCTTCTTGCACCACTCTAAGAAGAGACGGATGTTGGCCTTCGAG
TGGAAGACTGTGTTGAGCTTGTTCACCTTGAGATTGGCCTTGGGGTCCACGCCATTCGCCAGTAGACACAGCAAC