Description :
From Genome Similarity Track
Location :
Scaffold_36:44726- 51068
Sequence
6342 bases(100 bases per row)
tacgcggtcgaattgctctttctcgctgacttttacgtgcaattgaacactggattttaccaagatggtaatatccatcgggataaacgaagagcgcgga
tgaaatacgtgaaatccgccggcttcctgttggatgtggtcgctattctccccctttcgatcatactgtctacttgttcaactgtcggtactcgagagac
ctcctggtacgaattccataaaatcctgcggtgttttgtccaacttggatgacgtctacgccaagtattttcgagcgttaaagtcggttaaagtactgct
ggctatcgctctagtggctcacgtggtggcttgtggtcgatttgcattcggatggagtgatagcgtaccgtcatctgcattaagagacgactcaattcag
tacgtccaagcgttattctggagcgttgggcttttaaccggtggatttgaaggcgatttaccacgctacaagtcggaattcatcttcacgttggctgtga
tcttacttggctttatcctgttcatctactcgtgctctacactgtttatgctgtcgaaatccgagagtaaccagtccgttttagcacaagcgaggataaa
tcagcttggacatttgctcacgttccatcgagtaccggaagcgctacaaacccaagcagtagagtaccttaaacggcactacactgacgccgaatcgaat
gatcgtcaagtggttaaactcttgtgtccgtctataaccaaagacatccaagtggaacttctgaaggagatggtagcaagaatcccgctcttccgaggct
gcaatcaacagtttatcgtggctcttacgagtctattagagatgaccagtttcccgcgaatgtgacgctgttcgaggctggagatacaggggatttcatg
tacgtagtcaactctggagtgcttcatatcctcgtcaatgggcggaaagtgcgagaacttcgtcaaggaagcttcttcggtgaaatatctgtcttttccc
agcgtccacgctccgcagcggttgttacaacttcgtactgtacactatatcgcctttcaaagttctatactgagcgggtattggagggatatccagatta
cgcgctacagatcgcagcgacgattgaagcgatgctagaggagagtgaagaagggaaatccgcaagccgtgcaggtggggaggagtttatgctgacgacg
ctcttccatttaaccgcaaaatccccgaaaaagcgggcatctctgcgagatcgagctaaaagtgccgctaaagtttctttgagtcgcagtcaatccacga
gggttttatctgcctcaagacacgctgaaaatgacggagggaatatctcgatgaacgaaaatcgcgcaaagaattttaatccagctccgattaatctccc
tcctaaggttcttatcaagaaacccacattggtacgtagtcagtctgtttatgcgcgtcgagtgtcttctggaacgtcttggtggatgcatcgagctaca
agtgtgaaagacacacgagtggataatatgcaaggtttttatgacaatttatctcgacatcgaggatctcaccagctggctgggaatgttttatctcgtg
tatctcgtcggtttttactgcgacgggtggttgatcatacgtcgcaatggaggaagtattggctcattatcctgcaggttcacttggttgcgaactgtta
catcatcacactgcttttatccttttccatcctggattgtccgattatcaacgcaggggtctgtgctggatatgtcatcttggatattattctgctcatg
gatatttacttgaatttccacctaagttacactgagaagcgggagaaggtggtcgatccttcactgatcgcgaaacaatatctccgtggtgcgtttatag
cagatttattatgtattatcccgtatcgattcctcatccctctcagtatatcttccgttttgatgacccaccccgctctacttcgattacctcaattact
tcgggtttggcgcatgagaggacacataaaggagtgggaaaagtccttccgtctcagcagtacaggctggattttcgtctccggattggcctatctacta
ctacttcatctcgtagcttgtacctacttcagtctcacgtatgtcgaaggcttcggtattggcgattcgtggctacccactagcgaattggcagtgaaac
tgggtatgaattcctctagcagcgtgatgtattacgccagtagtcataccaattcatcctactctccatccgaggcccacgcagtggcaggtcttcagta
cgcgcgttccctgtactttggagctacaatgctgacaactttagggcgaactgtcgagccttcttcccatttccaatactctgtcgccttaatcctcatg
ttatgtggctttttatccatggcagtgatgatcaacacggttcaaaaacgacttaccgcctccgctttcgaacaaaaggagtttctagtcacccgcacaa
gagttcagcgatttatcacgtctcgaacggtaccaccaggtgtccaccaccgcgtcaaatccttcttggagttctggtggtcgtctcatcgtggagctgt
tatcggagacctgttgaatgaactaccggaaaccatcaaacgcccaatactacggagtatttgccagcctgctctgcgtacattatctctcctgccgaat
gtccggtcttcccttgaggctctggaagacgtttattgataatgtccgctttcttttatacggccaaggcgagattatttacagacaaggagactatgcc
agcggattgtttttcctacttgaaggtgaactcattattatcgctaacggaggagtcccaagaacgatcgtcaaaggaggttttatcggctctgcggcgt
taaatctgaacgaaacatccgtaagttacgccgagagagtgacgacagccagtggctgtattttactctttctttctcgggatcatctcgatgggatgca
taaagtcttccccacgttttcaatggcgcttcgagcgctagagaaaagagactttcagacacgaaattggcgcgagcacagcaggattttagcactcgag
agcgttcttttagtgggggattaagacccttgccagatttaaagcaactgacgttcgagatgaaagtcctcaaggttttaggtcttgaggatttaatctt
cgacccggacgatctgagttcggagatttgggcgctttggatttttggattaaatatcgcgctgtatctgaaagtgattggagatatttccactggggtg
aagatgaatgatgtcgtggggtcagaggttgttgcagtgattctagagtttttcttccttctcgacttttacttccactcccgtcttggatattatcaat
atgggaataagatgatggatattatccctatccgcaagggatttttccgatctcgtcaagtttggtgcgaagcccttgcacttgtgccgctgtacacaat
caactggatgcttggggcgctgaatcgctacgagcttctcagtatcaacaaattgctgcgtctcgctcgagccaccgagacttttatccaactggaagaa
aaacacctgagctggacattgagacttcggctgataaaactgattttactatcctatttgctctctcatctcttcggcagtatatggttcaattttgaga
cctccccttcgtcttggagtccgtctccacggctaaaatcttcagataaaaccgtccagtattcgggtttacttttctgggcattcggtctcatgtccaa
ctccttcgctggtgaatctcctaaaactgtcgcgcagtgttgctttactgtgcttgttcttcttactggtgtttgtctttttgcctacgtggttggaaat
atctcggatgtggtggaactactcgacgccaactcgcgggattttaacgcgaaattaagctccttgcggcatcttctaggtcatttccacctcccgcaat
ccatcgagcagcagctcaagacgtactttttcttccaacaataccacacaatcactcaggaatatctcttagagcggtgtctccctccttctcttttaac
cgaaatccgcctcgttcatctccatccgatgatcatcaaagtcgggtttctcgctggaatggaaggatccgtgacccggatgctcgtctctcagtttgta
caagctctgacagttaaagatcagtacgttttccacttgggagaagaaggaagtgatatgtttttcgtctttacggggataatcgaagttttggttccag
tggagactgttcaccgccgcaagtctcaggataatcccaattgtcatcctctcggatctccaactcggtcctcttttcatactttcttccctacgatgga
tcctttaaaactgcaggcgaaaaatcatttgaaaaaagtaaacgaactaacatccggcagttatttcggagaagtatctctgtttacgagtatgccccgc
agtgcacacactcgatgtcgaacgtcttgtgttctttatcgattatctcgacggtccttagagcttgtgttcgagcggtatccagattggaaacgcaagg
tgctgaagatcgtaaatatccaacaagagcagcaactattacggaacatgtacatggaagagcaaatgcataattcggcaaatatctcgaacaaaatgcc
ggatattctacgagatgccacgaatgctactactggtcgttcagctgatagtttttccgaccaaccagcgtcgagtccaagacgaagaactcggagttta
tcgtcacgtccgctgggtagtattaagcggaatggctctttcttctcgtcctataaggcacaacgttcagtatcgaccgatagtgccatcagtttacaga
cgccacagcaaaaatccgctggactctgggtggatttattgctgcagtgtactgatgcacagagtgttttccacgttcaatggctccggattattgcagc
tgggacgatttacatggcgctggttattccgtaccggaattcgtacgatttattggacagattgagccctctccccatcgttacgcgagtgttggaactc
acttgtgagcttgtgtttgggtgggatatttgggtgaattggaatctcaaagacggactgcaatcaatggaattgtacgaaagcagacagcgagaagctt
atcagaaggagcggctgtggatagatcttgtcgcagcgattccaattgaccatttcgtctcggatttttaccagtctccattgctcaatctcaaccgctg
tctgaaactggttaatttcccacactatatgagagaaatcaaccgtcgcagcgtagcgtacgagcagaaccgcctctgtacgctctggatcttgctgttc
gtgttaatccactggtgtgcgtgtgtgtatttttcaatctcttccactacaagacaagaggaaggttcagggtgggataattgggctcctccacaaagta
gtttggcgatttcgtgggaaaatccgccgttggatcttttgatgcttcggtttttacgtgggctttttttcgcttcgactgtggttttaaagaaaggaaa
agcattcgaaccaacaacctgctcggaatacactttcactctgttcgtggactttgtaggggtcgtagcagtggcgttgatgatcggggagatgcaaaat
ctttacgtgtcgtacatgagcaacgaagtcgagttccggaaaaaccacagcgcagtggatttatacctggaacgatggcacattaccggtcagttacgag
ctcgttctcaagctttcctgtcttcattgtggagttcccatcgtggcgtcaattaccaagcgattttcgatgaaattccaccagttatccggacagaagc
catcatgcagatcgcgtatttaccgctccgagtctttcttaacaacgttttccgcccttttgcaacgaaccacccgcacgacagggacgttgaggcaatt
actcgagggatagcccaacgtcttaagtacgaaggatatcctcgcgatgaaaaagtcctagtggaaggtagtatatccaaggaaatgtatttcgtcgtca
aaggccacctgatatcgaccagtgaagaaggatcggaagttaccgaacagcactacaagagaggggattacttcggagagcatgggttattgggcttttc
tgttggagtttcgactgttcaaaccgtttccgcctgtgatttactctctttaagctcggaagatcttctccaagtggtttgttcacgtcctcttttccaa
gcagcgttaagtatcgcagtagaagcttatcgggaactttgt