Description :
From Genome Similarity Track
Location :
Scaffold_5:447122- 465072
Transcript NameFunction/comments
Phyci_89712predicted protein
Phyci_89713phosphoglycolate phosphatase
Phyci_300158Hypothetical protein
Phyci_76659actinrelated protein 2/3 complex subunit putative
Phyci_76660conserved hypothetical protein
Phyci_76661conserved hypothetical protein
Phyci_209917Hypothetical protein
Phyci_89717conserved hypothetical protein
Phyci_101052Hypothetical protein

Sequence
17950 bases(100 bases per row)
GATGGTCAAGAGTAGCGCAGTGGGCGGCGGCCAGCTCGCGGCGGCCTTCGGCGTGGGCGTGGCAGCGGCCGTCGCAGCCCAGTACGTGTACCAGGTGGCC
CTCAAGCGGCGAGGCGGCGGCAGCAGCGCACGCGCGTCGACACCCGCGCCCCGCGGCACGGACGCCGCCGCGCAGGAGCTGCTGGAGGAGCAGCTGTCCC
GCATTGCGTCCTTCTTCGGGCCCGAGGGCTTCGCCAAGGTCAAGGACGCGTTCGTGGTGGTCGTGGGGCTGGGCGGCGTGGGCTCGCACGCCGCGCACAT
GCTGGCGCGCTCGGGCGTGGGCAAGCTGCGGCTCGTGGACTTCGACAACGTGACGCTGTCGTCGCTGAACCGCCACGCGGTGGCCACGCGCGCCGACGTG
GGGCTGTCCAAGGTGGCGGCCATGAAGCGCCACCTGCACGAGATCGTGCCGGACTGCGAGGTCGAGGCCATGGCCGTCATGTTCGAGGCGGGCAGCGCCG
ACGAGCTGCTGGAAGGTGCGCGACGGCAACGGAGCTGCTCTCGTGCAGAGAGACTGACGCTGTGGCGGTGCATTGAGCAGGCAACCCGACCTACGTGCTG
GACTGCATCGACGACGTCAAGACCAAGTGCGCGCTGCTGGAGAGCGTGACACGCAAGGGCCTCAAGGTCATCACGGCCACGGGAGCGGGCGCCAAGGCAG
ACCCGACCCGGCTGCAGATTGGCTCTCTCAAGGACGCTGTCCGTAAGTGATGACCAGTGGTGTTTCGCTGATGAGGTGGATCGTGTTGGAGGTGCTTATG
GCAGTTTGATGTTGCTGGTGTAACTATCCTAGGTGACCCGCTGGCGACCAAGATCCGGTACTTTTTGAAGAAGAAGGGCATTTCGTCGTCGGAGATCACG
ACCATCTTCTCGAGCGAGAAGAGCGTGTGCAAGCTGCTGCCGCTGGACGCCGAGCAGGCGCAGAACCCCGAGGAGTTCGGCAACGTGGAGAACTTCCGCA
TCCGCGTGATCCCCGTGCTGGGCACGATGCCCGCGCTCTTCGGACAGTCCATGGCGGCCTACGTGCTGTGCGACCTGGCCGGCAAGAAGATCAACCCGGA
GGCGGTGGCACGGCTGTCGCGCGACCAGCGCAACAAGCTGTACCAGAAGCTGCAGCAGCGTGAACACGTGTTGTTTCACGAAGGCCACAAGATTGAGCTC
GAGAAGGACGAGATCGAGTTCGTGTACCAGGAGATCTGGCGGGGGCGTAGCTCCGTGAGTGGCGCGAGGAACGGCGGCCACGATCGCCTGTATCTGGCTC
GTTGGCGGACGGACCGACCGCTGCACCCGGACAACGTGGTGTACCTGACGACCAAGGAGCTGGCCAAGCTGGACAAGGACGGCATCGAAGGCTTCGAGCC
GGAAGTGGTTGCCCGCATTGACGCTCGTCTGAGCCAGTTCGGCAGCTGGGCTGTGCCTCAGTAGAGAAGAAGCACACTACAACTTAGAAGAGGGCTCGAC
AGTTTTGTAGTCGATGTAGAGTTGCCCCACTCGAGCTTCCATGTACGTGTATCGCCGCAATAGGCGAATAAACTCGGTCTAAAATGGAGAAAGCACGGTA
CTATCGTTCTGCGACATGAGCCGAGTACGTCATCGATTTATCTTGGTTTTTGTATGCCTTCAGCCGTTACCGGGTACCATGCCTGTCCATGCCGCCACGA
GCTCACTTAGCATTCCCCCCCAGGAGCTACGCACGACCACCACCACCACCACCTCCAGCTATGGCGACCTCGAAGAAGATCACCCAGAGACTGACACGCG
AGGCCTTCAAGCAGTGGATCCAGGGCCTCGACGCCTTCCTCTTCGACTGCGATGGAGGTGCGCTGCGCGAACAACTGACGCAATCGGAGACCCGACTAAC
TGTGCGGGCCGTTGTTGATACTCGCAGTGCTGTGGCGTGGAGCTGCCCCGATCGAGGGCGCCGCCAACATGATCAGCCTCCTGCGCTCGCTCAACAAGCG
CGTGGTGTTTGTGGTAAGCTGGAGCTGCTGGGTCCAATGAAGTGGGGGAGAAAGCTGATGATGTTTTGTGCTGTGTAGACCAACAACGCCACCAACAGCC
GTGCCACCTACGTTAAGAAGCTTGGTATGATCTGTAAATTGTGCCGTGATAATGGTTGTAGTGGCTTACGGAGTGTGTTGTTCATGTGCTCCAGCTTCGC
AGGGTATCACTGCTGTTGAGGCCGACATCGTCACGTCAGTTGTGTAGTTAGAGATCAGATTTGGAGGCGATGCAAGCTAACGGTACCCTTCTGTGTGGGT
TTATACTACAGTTCGGCATGGGCGACTGTGCAGTACATGAAGCAGCACAAGATTGAGGGCAAGGTCTACATGGTGGGCGAGGCCGGTCTCCAGACGGAGC
TGGAGCTGGAGGGATACCAGGTCAACGGCATGGAGCACAGCGACATCAAGGGCCTGCCGCACGTGCCGGATATCGACATGGAGACGAAGGCGGTTGTTTG
CGGCCTGGACAGGTATGATACTGCGCCACGCCGTTTCTTGTTCGTTTGTGTGTTTGAGCTTACATTTTCTGTAGATACTTCTCATACTACAAGATGGCCT
ACGCCACGGCTTGTGTCCGTCAAATCCCGGGCTGCCACTTCATCGGCACTAACCCGTGAGTTCGCTTCCATTTTAGATTACGAGGTAGTGTTCATATTCT
CACTTTCCTGGCATTTTGCAGTGATTCGACGTTCCCGACGGATGGTGCGATCATCCCCGGTGGAGGCTCCCTGGTCCACATGCTGGAGTGCGCCATTGGC
CAGTACGTCCCGATTCCTTGCGTGACAGTGTGCTACTGAAGAGCGTACTAAGTTGCTTGCGCTTCTGATGTCACTTTAGCCCCCCTGAGGCCGTGTGCGG
CAAGCCGTCGCAGGACCTGCTGCAGACCATTCTTGCCACGTACAACCTAGACCCCTCTCGCACCTGCATGGTAGGAGCTCAGCAACTGCTGTAGCATTCA
AAACTGCAACTGACGCGGCGTATTTGTTAGGTCGGTGACCGTCTCTCCACGGACATTGAGTTCGGCAACGCTGGCGGCTTGAACACCTTGCTCGTGCTGA
CTGGAATCACGCACGAATCGGAGCTTAGGAGCATCGAAAATGTTCACCACATCCCGGACCACTACATTGAATCGGTTGATGTGATCAACCAGCTTCACGC
CGAGACACTCGAGAACTAAACTCTGCTTGCGCAGTCTGGTTGATTAGCGTAGGACACGGCAACGACAGCCTCCACCATTGTTTTGTCGCTGAATCGGGTA
CTACACCGCATTGAATAGATGCGATCGGATCAACGTGTTTATAACAATTTGATCCAGAGCGCTGAGTTTCACTCACCAGCAAAATCGCGCTACGATAGTA
TCTTACACCATGAACACCTACTGCAAGCTACACTGTCGGCGAACCATCTCCTCGGGCCTGTGGTTTCAGCCTAGGAATCGCACCACTATTGCCACTGTTC
ACAAATGCGTCGAACATCGAAAACCCTCCACCACTCACCGCACTACTTGCACCGCCTGCTGGAATGCCGAACCTATTGGCGTTGGCTGTTTTTTTCGGAC
GAACTGGAGCGGAATTCACACGGCGCGCAGAGTAATCTTTCGCTGCTGCGCTGCGAGCACTTGAAGCACGGGGACCTGGAGACGCAGCCTTCGGTTTGAC
TAGTGCCGAAGCCACCACAGGGGACATGAGCGGCGTAGGAGTTCGGAGAAATCGTGGCATCGGTGATTTCACCAGTCGCTTGGTGATCTCAAGGAACTGC
AGCTTCTTCGTCGGTGTCACATCTCCATCAACAGTTCCCCGTGGTCGCTTCCGCGTCGGTGCACGTAGGTTTTCCGGGGAATCATTGTCACTAATCAATC
CACTGCTGTTCAAACTGATGTTCAGATCTCCCTCGTCAATGGCCTGGTTACGTTGAGGGACGTCAACGTCTGCAGCGTCACTTTGTAAAACCTTCCGAAA
ATCTGCCCGCTTCGCCGCCAGAGATTTTGTCGCATCCTTGCCCTGTGTTTTCTTGGTCTTCTTTCCTAATACTTTAGGTGTGCTTATATCCTGCATCTTG
TTCATCCGCGCGAGCAACTCGGCATTTGCTAGCCGCTGCTTGATTGACATGGTTTCGGTTTTACCACCTACTTTTTTCTTAGGTGCCGGTGCAGTAACAT
TTTCATCTTCAACAGTCGACAGAGCTTCTTTAGCAGGGGGCTTTGTCTTCCCTTGCGCACTCTTCTTAGCTTTTGATGGACCGCCCACCGGCACAGCTTT
CCGTGCTTCGTTGTTCGCCGTCATTGCTGACTTGGCTTTGTCAGTCGCTCCACTCTTCTTAGGTTTGACTGCAACGGTCGTGTTCGCCATAGCTGCCATC
AAGTTGGCCCCTGCATTTATTGTGGTAGTGCTGGTTGCCTTCTCCTTTAACGCATCCTTCCGACGTTTCAAGCGCTTCTTCGGGGTTGGCGTTGACGGTG
CGGGCATTGGTTCAGGTTCCGTGTCAGCTCCATCGCTTTCACCATCTTCTGCACGGGCAGCAGCCTCCGCAGCCTTCGCCTGCCTCTTTGCTTCCGCGTT
CGAGAAATTGAAATCCAATGACGGCCCCCCTTTCTTCTTCGCGAACCGCTTCTGCGGAGTCAACATCTTCTTCTTGACAGGCGATGGTTGCACCTTCGGG
GAACTCGGAGTGGTAGCCAGAATCAAGCTCGCCACCGACGGCTCATCATCATTGTCAGAGTCGCTGCTCTTATCAAGCATGTTAAGCAATCCATCGTCCC
GCAGCTCCGGCAACGGGCTGTCATATCCACCCAGCTCATCCTGGTTATCTTCCGGCACCGACACCGACGCTGACTCGCCATCTTCCGGCTGAGCTGGCGG
CAAGACAGTAGGCGTGATCCTCTTCGGCGGCGGCACCTTCGCCTTCTGTTCCTGCTTCACTTCTTTCTTTTTCTTCTGCACCTTGGGCTTAGCCTTCGTC
TTCACCTTCACAGGTTTAGTGATATTCATGATCTGTTCAAGCTCCTCGTCAGGCTGCGAATCGTTCTCCTGCTGCTGCTTCTCATGCTCCACCTTCTTCT
GCCTCTGTAATTCTGCCCTTTCCTTCTCCTTACTAAGGGCCGCTTCCTTCTCCCGTTGGCGACGCAACGcctcggccttcgcctcccgctcagcctgctc
tctctgctgcttctcccgctcctgctcctgctcctgcctcagcctctcctgctcctGGCGCTTGAGACGGCGCATCTGGTGCTGGTAGCGGCTCTCCTCC
AGCTCCATCTCCTCCATCAGCAGGAACTGCTGCCACGTCTTCTGCAGCCGCTGGCGGCGCAGCTCGATGGACTCCCACTAGAATACACAACCATGTCAGC
GTTTCAACGCAGAATATATCGGGCTCTAGACATGGCCGAGACGCACCTCGAGGTTGTACGCCTCCAGCAGAATCTCCTCTGGGTACGGACCGCCGACGCG
GCCCGTCGCGCGCTCCGGAGGCTGCATGACGCCAGGCCAGCCCAGCAGCGCAGATAGCAGTTGTCGCTGCTCGCGCGCGTTGGCTGGGCGATTCAAACTG
CGTATGTTGGGGTGGACTACACACAATGTGGTGTGGTGCACACGTAGTTGAAGCGGTGCCTCTAGAGGGAGATCGGCGACACTTCTCCCTGTACTAGGAC
GCTGCATAATCCCTCTTCTCCTCGAAGCGGATCAATCCAAAGGGAGTCAGTCGATACAAAGCGCAAGACACTCGGACGACGGCATCATGGCAGCGGGGGG
CGACGCGAATCTGTTCCGGCTGGCGGACGGCATCTCGTGCCACGCGTGGAACAAGGACCGCTCCAAGCTGGCCATCTGCCCCAACAGCAACGAGATCTGG
ATCTACTCGGGCTGCCACGCGCCCGACCCGGCGCAGTGGCGCCGCGAGGCCGTGCTCACGGAGCACGACATGCTCGTGTGCGGGCTGGACTGGTCGCCCG
TGCACGACCAGCTCGTGTCCTGCTCGCACGACCGCAGCGCCTTCGTGTGGAAGTACGAGGCCGCCTACCGCCAGTGGAAGCCGCTGCTCGTGGTGCTGCG
CATCACGCGCGCCGCCACGAACGTCAAGTGGAGCCCCGACGGTACGAGCGCGGCTTGCAATGGCAATAGAGGGATGTAGGGACTCATTGCACTTATTTTA
TTGTTGATTGGGTGGCTGTGGCAGGCAAGAAGTTCGCGGTGAGCAGCGGCGCCAAGTGCGTGTCGGTGTGCTACTACCAGGCGGCGGAGAACTGGTGGGT
CAGCAAGATCATCAAGAAGCACAAGTCCACGTACGTGCAGCTTCAACTTGATCCCTGCTGGGGGGAGGAGAGAGGCTGACGTTGATGCCATTATGTGATA
TGCTGCTGCTGCCAGGGTGACGGACCTGGACTGGCACCCGAACAGCCAGCTCCTCGTGACCGGCAGCACGGACCTCAAGTGCCGCGTGTTCTCGGCGCAC
GTGAACGACGTGGATGGGCCGCCTGATGCCGGTCCGTTCGAGGCCCTGCCGCCTTTCGGTGAGCCGCTGGCCGAGTTCGACAACGCCAGCGCCTGGGTGA
ACGCCGTCGCGTGGTCCCCCAAGGGCGACCGCCTGGCCTTTGCTGGCCAGGGTTCGTCCATTCACATTGTCCAATTTGGCGCCCCGGGCGTGTACCCGAC
GATCCAGGTGAGGAGTGAGCGGAACGCGTGATCTGGATGTGCTCTGCGTGTGCTGATGCTCGATTATGTTGAATGGGGATGGTATACTTTATTGCAGTCG
ATCCGGTTCTCGCACCTGCCGCTGATGCGCATTATGTTTCTGTCGAACTCGGCCATCGTCGGCGTGGGTTATGACTTCAACCCACTTCTGTTCTCGCAGG
ACGCCAACAACTTCTGGTACGGATCTCGCTGCATACTCGAAAAAAATGCGACTAACGTGGATATTTGTTTCTAGGTCCTTCTCGGAATTTGTAGACAAGA
AGCCTGCGGAGAGCGCTGTGAAGAGGAACTCGGGCGGCTTCAGCGCTGGTAAGATCAGTCCATGGTTTGTTCTTGCTGGAGTCGATTTTGGCGCTGATGT
GTCTTGTGTCCAATGCTTATTTAAATCCCAGCTCGAAGCCTGTTCGAGAGCAAGGTGACACGTGGTCAGTCGTCAGATGCCACTCAGCACGACAAGAACA
TGCTGTGGATGTACGTTATTATCTCGATCTTGGCGTGACGAGGTGTAGAAGCAGCATTGCTAATATGTGTTCGCTATCGGTGCAGGAAACACGAGAGCAA
CATCACATGCATTCAACCGTACGCACGCTCCCCATCTGGAGGTGTCACGGAATTCTCCACCTCGGGTACGATTTATTTGGAACCTGTCGAGGTAACTTGT
GCCTATGGTCTAACCGCTAAAATTCTGTGGTGGGGGTCATTCATGTAGCACTGGACGGCCGCGTTGTTGTGTGGAAGCTGGGAAGTTTGAATGTCGAAAT
GAGCAAGCTGCACCTGTAAGTGGACGTTTGTTCGCTTAACCCGGCACGGCACGACGAAAAGGCTCAGCAGCTCAACCGTAGACTCAAGAGCAGCATAAAA
AATGGTGCCCCAATGCGACGCTGGCTAAACAAACCCGATACCAGAAGGCACTACAAGATCACGAAGCCCGGCATTTCATCTTTTTCGTCGATTGCACTGT
GTATCCTCCTTCTATCTACCTACCCACGCGTCTTTCGTACTATAACAAGCGCAACGACACCTCTATTCGTACATACGCTTTAGCCGTCTATACTCTTGGC
GATACTGGTTCTCAACCACCGAGGCCTGGCGAAAGTCTTTCCACTCCGGGAACTCTGTCAGCAGAACCTTGGGGTCGTACGAGAGCAGTAGTTGGATGCC
CTGGCTAACGTCATTCAGCGTACGCGCCAAGTCAATGTGGTCTGGGTTCAGGTATGTCCGCTGGAGCTCCAGCAGCTCATAACTGCTGCGTAGGAACAGG
ATCGAGTACTCACACACCCGCTCGGTTTTCGCACGCAGCAGCAAGTCGCACGAGTCCGCTACCAACTTGTGGATGCGCATAAATACCAAGTGGTCGTGGG
CCACGATCTCAAGTGCATCGGACAGAGTCTCAAGTGCCACCGAAAGAGCAGCGGTAGCGCTTTCCGGGTTCGTCTTGATAATCTCCTCAGCGCCTACCAG
CACCTTTTCCAGGTCTTGCATCCCAGGCTTCGTGCTGTCATCTTCATTCCCCGCGCTCGCCGGCGGCGGCAGCACGCTGTCGCCTCGCTTGCAGAGCTCG
CAGCTGCACTCGAAGCCGAACTGCTCCCAGAGGTTCTTCCGTCGGTTCTCGCGACTCTGCTCGCGCGGGTACAAGTAGGAGATCGTAAGCTGCTCGCCCT
TGGCGATGGGTCTCGCCACCCGCACCTCCGACACGCCTCCTTCCGGGCCGGCGTCCTCGGGCGTGAACTTGACGCAGTTGGGGTTGCAGTCGTGGTTGAA
CATGGCGTTGTACAGGAACACGCCGCTGTCGAAAGCGTTGCACTGCATGGCGAACACGTTCTGCAGCACCTGGTCGTGCGCCAGCGCCAGCTCGCTGAAG
TTCCTGCACAATTCGTCCACCTGCGGGCCGTACTTCTCCCTGCCGGCAGCCAGCAGCTCCTCGGGCAGCTCGCTGAGCTTCTCCGGGTACAGGTGGCCCA
GGTGTTCCATGATGTCGGCGTAGTCGGGCCTGGACAGCACGGACTCCATCGTTGCCAGGAAGAACTCCGGGTCCGCCGTGTCCACGTCGCTGGGCCAGGG
CACGTACACCTGCTCCACCAGCACCTGCGTGCCCGGCTTCAGGTCGCGCGTGGCCACGTAGCCTCGCGATCCTCCCACGCCATCGAAGCTGGTAGCCAGC
TCGATGGGGCCCACGGCCAGCGGCTTGACGTCGTCCCAGGGCGCGTACAGGCTGCGCGTCACCTCCGTCGTGGCTTCCTGCGCCTGTTTCACGGCAGTTG
GCTGTGCAGCAGGCGCGGACGCTATGTGCACCACCTCGTGCGGCTGGAGCGCGGCCTCCTCGTCGCTGCTGTCGTCGTCGAAGAGCCCGAAGGCCGCCTG
CACGGAGGCACTCGGCTTGCCACTCATGGCGCTGGTGGTTGACTGACGTCGAAGCGCGGCGCCACACCAGGCGCACACAAGTGTTTTTTTTATTTTCGTC
AATTTGACGCTTCACTTGGTCTTTGTATGCGGAAGGCGAGGGACCCCCCACTGGCTTTTGTGGAGCGCAGGTCAGTAGCCAAGCGACTCAGTCTCAGATG
GCTGAGGACCTCAGCGGCATGACCGACGTCGCCGGCCGCAAGCACCCGCGCGCGCAAGCGCAGCCGTTCATGGACGCCGCAGGGCTGCCACCGTTCGCCG
CGGAGCCGCAGACGCAGACGCAGACGCAGACGCAGACGCAGACAGCGACGCCGTCGGGGCTGCCCGCGGGCCGCCGCATGCGCCTGACGCTCGGCCAGAA
GCGCGAGGTGGTGGACCTGGCGGCCAGCAAGAAGTTCACGCACCGCGAGCTGGCCGAGAAGTTCCGCGTGGGGCGCACCACCATCACCAACATCTGCCGC
CAGGAGGACCTGATCCGCACGGAGACGGACTCGGCCGACGCCACCAAGAAGAAGCGCAAGACCACCAAGTGCACGTACGACCTGCGCGTGCTGGACGAGT
GCCTGCACAAGTGGCGCATGGAGATCAAGGTGTCCAGCCCCGACACGAAGCTCACGGGCACGGTGCTGCAGCACAAGGCCATGGAGCTGGCCTGCAAGAT
CGTGCAGGAGCCCTACGCCGCGCTGCCCGACAAGGTCAAGCAGGCGCTGCAGAAGTTCACGGGCTCCAACGGCTGGCTGGACGGCTACCGCACGCGCTTC
GGCTCCTTCAGCAGCAAGCAGCTGCCCGGCGGGGGCGACCAGAACGTCATCAAGAGCGGGGACGTGCAGACGCGGCTCCGGGAGCTGCACCACAGCCTCA
GGGGCGTGGATCTGGAGGACATTTGGACGGGCGGCGAGTTCGCGCTCATGTACAAACCGCCGGTGCCCGAGCCCGTGGGCGGGAGTGGCGCTGGAGCAGT
GGGAAACGGCAGATACACCGTGTCGCTGGTTGTGAGCGCGGCCGGGGAAAAGTTCGACTTGCAAGTGATTGGCACGGACCGCAACCCGCTGCTGCTGGAG
GGCGTTGATACCAAGGAGACGTACAATATTCAGTATGGCTACTCGAAAACGGGCTGGCAGGTGGCGCAGACGACAGTGAACATGTTGAAGTCGCTGAACG
CACTGGCGCGAGAGAGGAAGCGCACTTTTCGCGTGATTCTGGACTCGGCTGTGCCGCACGTCAAGGCCGCCATGATTTTGGATTCGCAGGGAGACCAGCG
CACGTTCTTCGTGTACGACCATCTTCAGATTTACTTCCTGCCGCCCAATTTTAAGGAGTCCCGCTTCCACCCGTGCCACCTCGGTGTGATTCAAACCTTC
AAGGCGCGTTATCGCTGTGAGATGCTGGAGACACTGTTCAACAACTACCGACAGAGTGTGATGAGTCAGGACCCGCGCGGATTCCACCCACAGCGCCACT
TGCACACCCGCAACGTCTTCCATTGGCTCTACGTCGCTCTGCACAGTCTCGACAAGCAGCTTATTCAGACGTGCTGGGTACACAGCGGTCTGTTGCCCAC
CCAGGCTGTTGCCTCCCTCAATTTGCGTGCCATTTTAAGGACCGCCAGCACCTCGCCCGTCAACCTGTCTCCGAACACTTCCAACGGCAGTGGCAGCGAT
AGTGCTACCGGCAACGCGAACGGCAGTGAGGTCAACGGGCTGACTCCGTATGAAACTCCAACTGGTGCTGGTTCAACAGTAACAACCAGTTTTCAAGGAG
GTTTGCCGACCCCTGCGCTGTTATACCGAGATTTACAACGTCAGCTGACAAAGATCGCCCAGCATGCCCCCGATTTTCTCCGCTGGGTTGGTGTGACCGA
CCCAACTAACGCACAAACATTCGTGGAAATTGAAGGCAACGCGTCAGTGACCGACCCAGGGATCGATGAGGTGCAGATCATCCGCGGAGTGCTACAGAAG
CATGGATATTTATCCACAAAGAAGCTCGACGATGAGAGTCATGCAGAAGGATCATACGAGACCTTCGATGATGTGGCCGAGGAAGTCTGTCCGCGACATG
AGGAAGTTGCAGCGTCCATTGGTATTCTCAAGAAATACTTGCGTCTATCGAGAAACGCGATACCGAACCGCGTCGATGCTGTCGTGCAACTCAACGAGAT
CAAAAAGGCTATTGATGCTACTGACGCCATTCGAGATGTGTGATTCGGTGTGCGGTATTGTTATATACTACAGCGTGTATTTGGCATCGGTCTCACTGTA
TTATCGTACTGTGGTTGAGCTTTATCTTTTATCTTACAACACATGCCAGCTCCTTCAAACGGGTGGGTGGTCTAGTACACAGTACGGATCTTATAGTTAG
GGGGGATTGCAGTCACCATGGCAGTATCCTCGAGACGTCGAGTAGTGTGTGCTGATCGTGGCAACGGCGTTTGCGTGGGTGAAGTTAGTTCGGGTCTCAA
ATCGTCGTCCAGCGGCAGGATTGCACGTTCCGCGATGGCCTGCTGCTCGATGCGTCGTTGGCGCCTCGCGTAAGCTACGAGGGTGCGTAATGCGCTGACA
AGCCAATCGCGATGGCTCGAGCTCTGCGTCTCCAGGTCTAGCGTCCGTCCTCGAAAGACCACCGAAAATGAGCAAGACTCCAGAATGCGGCTGGATGCAT
ACTTGCGAAACACAGCCGTTTGTCTGCCGTCCAGCACTTGCAACACCTCAGCTAAGTCGACTGCTCCACTCAATCCACCACGTTTGTGCTGCCACTGCAA
TGTTCCGCAGCAGTTGCAGTGAAGTCTGGTGGCGTGAGCGCCGCCACGTCGGCCATACTTCAGCAAAGGAAAGAACATGTTGATAGCCTGCACCAGATAT
GACCGGTGCTTGCCACCGAACCGGAACGCCAACTCCACGATTTTCCACCGCGCACCTTCAATGGACTCCAGCTCTTCGTCTGTGAACAAGTACGTCTTTC
GTTTCTTCCGTAAGTGGAGTGTCTCCAGCACGCGCGGGCCAAGTCTCGAAAATGCGCTCTTCTTTTGCTTCTTGCCAGGGTGGACATCTTGCGGGACGAG
CGCGGGGCTAATCGCTGGTGGCGTGGGCATCGGCGAGACGTCATGAGATGAGAGGAAGCCATCCAGCCCCAGGTCGTACGAGTTCGGGCAAGACCCCGCT
CTCCTCCGCGTCGGGGTGTCCCTCAGGGACTCCTTGGGCTTGCACCGGATTCCGTGCGACTGGGTTAGCGGTTGGCGCAGCTGATCTGAGTCATCCTTCA
GCTGGATCACTAACCGCCGCACACTCGAAGTCAGTTGGTCCTGCGCCGTCAGCGCGGCTCGCTCGGCTGCGCAGCTCAGCAGGCGGGTGCGTCGTCGCTG
AAGTAGTCGGTGTTCCGCCGGACTCAGCTCCTGCACCAGTTCTTGCTCCACCTGGGCGATCGTCTCTTCTTCCTCGGCACTGGATCTTtcttcgtcgtgc
tcagcattgttgttgtccagatcgagctcctcgacgtcgtcgatcaggtcaacatcttcgtcgtcgtcttcgtccgagtcgccgtcatcttcctcttcCT
GGTTCGACACCGCATGCGCGAAGGGCGCCTCCGACTCGCTCAGCAGACTCTCGCTCTTGATCCGGTTCATCAGCGTGCGCACGCTCGCGGGCATGTTCAC
GGGATCAAAGTCCAGCAGCTCCTCGTCATCCGCAAAGACTCCAGtcctctccgcctcctctatctcttcttcctcgtccgcgtcgatggctgctcgtcgt
tcctcttcctcgagggtctcctgctggttgttgtccatctcttctccctcttcttgctgctcagcgtcctgtgcctccaccgcctcctccttctcctcct
gttcgtccGACAGCAGCACCGCCGGCGCGAAGCCTGCATGCATGGCTGCAAAGTCCCCGAGCTGCGCCTCGAGCTCGCCCCTCCGTGCAAGCTCCTCCGG
GGTCAGCGGGGGAGCCAGCGCCACCGCCACCAGCGTCCGTGTCGGGTAGAACTGGAACCGCTGGGCGCGCACGCCGGCGCCGCTGCCGCTCGCGCGCGGG
TCCCACAGCGTCATGCCCGACTGCGTGGGCGTTCCGGCGATGCTACTGCGTCGTGCGTGGCGCGCTGTGGCCGTTGTCGCCGTCGCGTCGCCGTCCTTGT
CCTCGTAgctgccgctgctgctgctgctgccgcGCGCATCCTCCGGGTCGGCCTGGAACAGGCTGCCGCGCCGCACGATGGCCGAGAGCTTGCCGAGCAG
CACCACGCTGGACGAGCGCTCGCGCTCGCGGCGGCCGCCTGCCCACGGCTGCATCGCGTCGCCAAGTGAGCCGAGCTGGTCGGTAAGAAAATCCGAGCCC
GCGGGGTCCGCGGTAGAGTGGGAGTCCGGTTGCCTCGACGCGAAAGCAAGTGCCCCGACCTCGCGCCGACCGAGGGAGGAAGAAGGAGAGGAGAGCGATA
ACCGTCGGACACGCGCGCGCGCGCTGTAACAGCAAGTGGCTGCGCGTGCGAGAAGAGTTGTGGCCGGACCGGCAGCCGGGCTTTCCCTTGGCGACTGGAG
CGGCGGAGGCTGACTACCGTGGCACGAGTGGACGGACGCGTTAAAACTAGCAGGCAGCGAGCCGTTGCCGTTGCCGCGCTGTGCACGTGGGTGGGTGGGC
GCGTGAGTGAGGCGAGCGGATTCCGGCACTGGTGCAAGTTTGTTGGCAGGTGTCTTCAATGTGCAACGGCGTGTAGCCATGTCCGTTTTCGCGGGCGTAT
CGACTGTTAAAATTTGGTGTCGAGCCAGCTGCCGTGTTCGTCGACAGACGGAAGGGATCGATTTCCACAGGTCCGAGCCGCCAGCCAAGAGCCGTTACGG
CGCTGCTGGACGCTCGCCAACGCACCGTGAGTTCCTCCGACTCGGCTGCGAGTCCTGCACCAGAGTCGCCCCCACACCGGCCACGATGGCCCGCAGCCCA
GCGCTCGCCGACCACATGGCCTAGTCTCTCGCGAGCGCTCACGGGCTCCGATGGTCTCCATCCCCCCTCTGTGCCTCCTCAGACGCCGCGGCCCTGGACT
CTACTGCGCCTCGCTGCAGCCGACCGGGCGGAAGACCACCAGCGCCACACAGCACGCTGCAGTCTGCTGGGGTTCACTGGACTCCCCAACCCGCGGCTCT
TGCTACATCCCGCTGGAGTGAGCGCTGACGCACGTACGGTACCGTTTTACAGGTACACCCTGCAAAAGGCGACATGGTGTACACTTGGTGTACAGTTGCA
ATCCAATCGACGCCGTAATGGTGAGTGGTGGCAAGGCTCCTCGACGCGGCGCGGCGCAACGGCGCGCGCGGCTGCAGGGCGCCAACGCGCTGCTGCTGAG
CGGCCCGGACAGCTCGTACCCGTCCTCGCGTCTGCTGGTGTGGCACTCACGCTTCTCGCACGCGGCCTCCCGCCACGAGAGCGTCGTGTCCGGCCACGCC
CTGAATCAGCAGCTGGAGGTGTTTCTGCCCGCCAAGGGCGGCAAGGCCGCAGCGCAGTCGCTGCAATGGGAGACGGGCTTCTACTACGAGGTGAAGGCAT
CCGTGGACATGTTCCTGTCGCCGGCGTTCATCAGCGAGTACCTGGCAGACGGAGGCGCCGTGTTCATGGTGGCCAAGAACGCGGCGGTGGACGCGGCGCA
GTCGGCGATGCTGCTGCCCTCGGGCCAGCTGCTGCTGCTGGTAGACGCACCCACGTACCAGCAACTGGGCGTCGTTGGCGAGAAGTACGGCAAGGCGGTG
CCCCGCACGTGCAGGTCGACGCGCGGCCAGAAGTACGTCATCACGCTGGACTTGACGTCGCCGACGTTCGCGGAGGAAGGGGAAAACGCTTTTAGAGATC
GAGTGAGGAAGGCTTTGAGCTCGAAACTGGAAGACCTGGAGATGTTCATGTGCGCGTACAATCAACGCGGCGCCGCGCGGACGATCTTGTTCGGGGATGA
TGACACGGTGCCGCGCCAACGCGTGGACCTGAACGCGCAGATGACGACGTTCGGTGAGGTGTTCCTGCCCAAATTTGACGCGTTTTACGCGCAGCTTGGC
GGGAAGGAGAAGCGTGATGAGGAAGGTGGAGAGAAGCTAAGGACGTCGCTGCAGGAGGCCTACGACTGGCTGGGGCTGGTGGCGTGCCGATTGACCGATC
TGCTGCAGAGGCGGAAGCTGGAGGAGTACGTGTCAACCTACTCGGGCATCCCCGACTCGTTCGAGTGCGAACCGGACAGTGAAGTGACCACAGTACGGTG
GCGCGGACTGCTGGCGGCACCGTTTTGTGCGACGATTGTGGAGAAGGTGCAGCGGGCTGTGAAAAACGGCGAGGTGCCCTGGGGTGCGGTCACGGTTTGG
GGCTTCCCGGACGTCTTCGTGTCGTGGGTGCAGCCGGCCAACAGCAACAAGACGAAGAGTGAGACGCAACGGCGAGAACATGGATACCTGGGTAATGGCA
GCAACAACTACACCCTGCTTATTTTACCGAACGACGAGTACTTCATGCTGCAGGCGCTCGGACCGCATGACGCCACGGTGTAAGAAGCGAAAGTTATCAG
CCAAGAAGCAGAGGAACAATACAATAGAACGTTGCAACATCACATGAATTTTATCATGCCTATCAGACAATACTCTAGCTAGTTAGCGAGAACGTTCTCC
ACAAAAGCTGCGACAGTGGACGAGTTGGAGTCGCCCCCAGCCTCGGCGAGCGCAACAGCAATCTTGATGTGCTTGCGAGCCGGCTTCACGTTGTTCTTTT
TGCCGTGGATAATCGCAAGCCGCAGGTTCGCCAAGAAGCAAGCGGCCACGTTGCTGTTGCTGCTCAAGGCTGTAGTAGTGCTGCTCACATCGTCGTCGCC
TTCAGTCGTGGTGGGGGACTTGGTCGCCGTTAATGAGGCCACAAGCTTCCACACGCTAATAGCAGCGTCTAGGAACTGTTCTTCTTCGTATAGCCCGCCG
AGCTCAATGAGGATCGGGACCAACCTGCTTGACGAACTCTCACTTGCAGCAGTCGAAGCAGCAGCAACAATGCCCAGATACTTTTCGATAGACTTTGTCG
AGCTTGAAATTGAAAGCAGTCGTGCCTCAAGCAACTCCGTGTCAACTGAACGTCCCAGAACACCGCTCTCTTCTGCCGCTGTCACTCGCTCTAGTGTTGT
GTTCGAGAGAACAATCGCCTGATCCCGCTCGCCAAGCTTAACGAAGCAGTAGCATATCAACAGCTCCAACTGAGCTGCATCGTATTCTTTCCCATTTGCA
TCAACAGCCAGCGTCAAACCGGTCTGCAGTAGGCGCAGCAACTGACGAAGAACTTCATCGTGAGATGCCTGCTTGGTTTCGAGCCCAATGCGCTTGAGAA
TGCTTGTGCCAGCCAAAATGTAGGCTTGCGGGTTCCACGGCTGGGCACGAACCAGCTTCTGCGCATCCAAGCACAACCCCTTAGCTCCAGATGGGCCCGC
CTTGAATAAGCCCACCAGTGCGTCCAAGTAGTTGCGATCCACCGTCTCGTTACCAGAGGATGGCACGTTCCTGGCACCCGAGCGCAAGTACTCAGCGAGA
CAATCCGACACTTGAAGGCTTTGTGAGTCAATCGTCGCAAGTGCCAGCCGCATCCATAGCGGGCTAGAGTTTGCACAGTCATTAGCTTGCGATAATGCTT
GCAGCCGCGACAAGTAAGCATCTTCAGCACCCACAAAGCGTTCGTGAAGCTCAACCAAGCGCAGATTCAGATAGTCGCGCGTTGTCAGCGTCGACTCCGC
TTGATCGATCAACGACAAAAGACGTTCCTTACACAGAGTAGCGACATTAGTTGCCTGAGAAGAAAACTTGCCCATCAACAAGCTCGCAATCGATAACCCC
ACAAGAGCAACGACTTCGCTTTCTCTGGATTGGGAGTCCTCTTGCAAGAGCAATGCCTGCAGCAAACTTAGTGCTGCACCCCCCTTCGACTGCCGGTACA
ATATCTGGGCTTGCACGATGACCTGCAACGCCGATGATGCACCAGACGTCGCCTTAATCTGAGCGGCAATTTGTTCCAAGAGTGCCGACTCCTCAACGTT
CGTATCGTGGGAATTCGTGGACAACCCACCGAGCTTAGTTATCAGCGTATTCCATTCAAGCCCTTCAGATGCTTGTGGGGACGAGGCTGCACGGGTGTAG
GACGCCAATGCCTCGGAATACAGACCAAGTCGATGCTGTGCAACACCAAGTGCGTGCCATGCGCGGCTGTTGAATGGATCCCGTTCCAAGTACTTTTTCA
GATAGAACATCATCTGCTCGTTGCCATGCTCTGGAGCTTGAGTTATCGACTCACCGACGCTTGCTCCGTAATCAAGCAATGCCATGCTCAACCCCAGCAA
AGCATCCAAGTCCAACCCGACCTGCAGAGCACAGTCAAAAGCTTCGATAGCTTTTCTCTGCTGAATTATCGAAGTACCTTGGCGGCGAGCTAGCATTGCA
TACCCATTCCACATGGATGGGTTACTAGGATTCATGCTCTGCAGCTGGAGGAATGACTTCTGCGCCAAAGATGCTGTGGACGGCACAGCATCACTTTGAC
TGAGGTAGAACATACCCAGGTTCGCCCACGTGGCATCACTGCTGCTACCAGTCTGAATTGCACGTGCCCATGCAAACTGCTTCACCAGTAAATTATCGGA
CACAAGAGCCAGACCGTTCCACGCCAGCGAGCACGAAGGATCTTCTTGAAGGGCCAACTTGAAATTCGTTGATGCTTTTGTCTTCAAGTTTGCAACCGTT
GCTTCGGCCTCACTGTTGGATTGGTTTCTCTCGATTGAGAAAGCTGAAGT