Description :
From Genome Similarity Track
Location :
Scaffold_1929:4470- 6317
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1929-snap-gene-0.5Leucine-rich repeat-containing protein 56.
Pytiw_DAOMBR242034maker-piw_contig_1929-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
1847 bases(100 bases per row)
ATCACTTGGATATCTTCGTGCAGCATCAGCGGGCTGAGGTCGCTGATGTCATTGTACCGCAGGTAGAGCTCCTGGAGACCGGTGAGTGCGCCGATGCCGT
CCAGGTCGTTGATGCCGCTGCGCATGACCCAGAGGATCTGCAGCGCGTGCAGCGACGTGCCCAGGTCTCGAAAGCTGTGCAACGTGCTGTTCTGCAGCTT
GAGCTGCTGTAGCGACGGCAGCAGCTCGCCGATCACCTCAACCGACTGCTTGCCCGAGTCCACAGCAAGCTGCAGAAACGTCACGCGCGCCAGGTCCTGC
TTGCCGCTGAGCTTTTGCTGCAGCGGGCATGGTAAGAGTCCCGTTGTCAGTGCGAACAGTATAGGAACCACAACTATGCACATTCGTTTTGCGTACCAGT
TTCTCTTCGGTGATGTCGTCGAACGGGTTGTCTGGCAGGTGCACCTCGCTGTCAGCTGCTGACGTGTGGAGCGTCTTGTGGTGCGGCGACGTGCGAGCCG
AGGGCGAGAGCAGCTGCGTCCCACCACAGTTACTACTAGAAACGCTGTGGTGCGCTGTCACGGGTGTCGGGTTGCAGTCCTTCGGCAGCGTGCGGATGAG
GAACTTGGCCTTGGCCGGTGCTTTCGCGACGGCCGCGCGGCTCAGCAGCGCCACGTCGTCCATTTCTTCTCGCAGGTCGATCGTCGGCGCCACGAGACTC
ATGCTCTCTCAACGAAGCTCCCAAGCTCTGGAGCTCGGCGAATGGGCACAGGCGCACAGACAGAGGCGCACAGGATGTGCTTGCTGCTGGTCATGGTGAG
GAGCTATTTCCAGGTGAATGAATGAGCTATTGATAGACGCGAAGTGCAGTGGAGCAGCTCGCTCTTGCGCCAGACCTCGTGGTCGCATTTCACCACCAGC
TCGATGCTGGTGTCGGTCACGCGGTCGTCCAGGATGCGCTGCGTCTCGCGCTGCAGCGCCTCGTACAGGCTCGTAGGCGCGGGCGACTCCTGCGTCGGCG
TCATTTTTGCTCTTGTTGAACCGGTATCAGCTGAGTCCCCTCCTAAACCCGATCAGAAAACGATCGTTTTCGGACTTTNNNNNNNNNNACAAAATAATGG
ATTTTTTTCACAAAACCCCGGCAAAGTTCGTATTTGACCTGAAAATACTCAGATTATCAGAAATACTGTTCTCTAATTGGCTCCGACAGCTTTTTACAAC
ATCTTTCAGTATACTTTTTTTCACATGTTCGGACTTATGGACTCCGACTAAGTCCGAATATGAGCTGTTTGAAAAAGCTGTCAGAGCGCATTCTCAGAAG
ACTCAGGCATTCTCAGAAAAAAGTTTCGTTCAGTACAGTCTCTATAAAGTACGCTTGTGGATTTCGTACTTATCTGGAGCACAAATATCCAATCAGCAGC
TTTTCATTTTCAAAGCTTGGTGGTGGAGACGCAGAGGTCACGACAGCATGGACGCCGCAGTGACGACGACGACGAGGCCCGTGGGCGGCGTGGCCGTGCC
GCACGCCTCTGCAGCACGCCTCAGCACTGCGGACGCATCTGCTGCAGCCTCGGATTCTGCTGAGGCGGGCGAGAGTAAGCGCAAAGCGGACTCGTCGTAC
GTCTTCCTGCGCATCAAGCGCCGTCGCAACGAAGTGCCTGTCGAGTGCCTCGTGGTGCAGAGCGAACGTAGCGCTGGTGACACGCAGACGGCGCGTACCG
CTGGAGATGGTTCGTACGAGAGCGCGGGCGCAGCAGACGGCGACGATGACGGAGAGCGCAAGCGGAAGAAGAGCGCTGCCGCGCCTTCGTCGAAGGACCT
GCTCAATGCGTTCACCAAGCTATCCACAAAAGAGAAGAGGTGCGTGC