Description :
From Genome Similarity Track
Location :
Scaffold_1473:4470- 6184
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1473-snap-gene-0.4Conserved gene of unknown function

Sequence
1714 bases(100 bases per row)
CATAGATGCTTCGCAAAGTCATTTCGTGCAGGATATCGTCGTCCAACGCATCAAACCCAGCAACGGGCGCAAACGTGAGCACTTCGCGTGCCATGATGCT
TTCCGTGAGAATCGGTTTTAGCACGACGTCGCCAAACACATGAAAGTACTCTGCACGCAATGTTTGGACTGCGAGTCCGTCGTTTCCAACGACAGACGCA
AGAAATGGGAGCAGCGACGGCGACTTGGTGTAGAGAAGCACGGCCGTGATGATGAAGAGCGGACATGCCTTCTTGGTATTGTACAGCGAGAAAATGCACT
GCTGCGAGAGCGAAAGGATCGACTTCGTCGCCTCATCACGTTGGCTCGGGATCTTGTTGAGTGCTGGAGCGAGCGGGTAGCACAGGAAGACGACCAGCAC
GTACGCCAAACTGACCATGCGGCTGGTGAGGATCGACGAGTTCTGACTATCCTTGGAGGCTCTGTCACACCAGCGCAGCAACTGTGTGATTTCGTGGTCA
GACGGACGAAAGTTCGCCATGACCAGGAAGCCGATGAACACGTTGAGAATCGACACGATCATGAATGGTGACGATGTGTGCCCATCCAGACTCTCAAGCA
GGTGCTGGCGCAGGACACTTTGCGTCTCGATGGCAGATTGCTGCAGCGGGTGCTGGCCTTCCTGCTTGCCTTCTGCTGCATTGTCAGCTACACCAAGACG
CAGGTACGCTGAGAAGGTTCCCGAAACACTAGCTTCCGGCGCAGATGAGGCTTCTTGTTTCATGAGTTGGAAAAGGTACGCTGGGATATCGTCATGCAGT
GCAGGAATCGTTGCGGTCAAGTGAAGCGCGATCGCGAGCGTCCATAGAGACTTGCTTTCACTGAGCTTGGATCTGGTGAACACTGCATAAGTTGGCGCAA
GTGAGGCAAGCGCGACGCACGTCTTCTCGGCTTGAACAAACTCCACTGGTAGCGTCGATCCAGCCGTCTCCTGCGCATTCTGTGGCTGGACATGCACCAA
ACTCTCGATCACACCGTCAAGTACGTGGTCCACGATCGACGGATCATTGAGCACCAGGCGTTCCAGGATTGCGACTCCAAGCGGGATGCTTAGACAGAAC
CGAACAATGGAGCTCAAATGGAACGGCGATGCCTCCACGGTCTGCAGCGAAGGACTCGCGAGTGCATTCACAAAGATCGCCACCAGGTCGTCTTTGTAGA
TGCCGTTGGCAAAGAGTTCACTCTCGCGGACGCCACGCGTCGGTTGACTCTGGAAGCTCTGCGTGTACACCTCGGCGAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCTTTCGCGTTCTCAAAGCGTCGATACATCGGCATCTGTGGCATCTTCTGCTGTTGCTGCTCGCGTAGCTGCTGGT
GCGCAAACTTCTCAACGTCGCTCACTTGCAGGTACTGGAACACGTGCGCGTACTCGCGCAGCATATTCACCTGTTCAAACTGAACCAGCACTCTCGAGAT
CCCGCGGCTCTTGTGACGTGCATCCGTGGAGCTCGCATGAGCCGCCTGCGCGTAGTCGAGACGCGTGAGCAGCGGCAGGAACGGCGCGAGCATCAGCTGC
GCCGCGTCACCGTATCTCTCGTCCATTTTGGTGGTGTCGGCGCTCGCGGGAAGCTCCTGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTGG
CGATGGTGTTGAGA