Description :
From Genome Similarity Track
Location :
Scaffold_2696:447- 1449
Sequence
1002 bases(100 bases per row)
CTGCGCGCTGCTGCAGTCGCTTCTGCGCTGCGATCTGCTCTCGGAGCGCGCGCTGCACTCGGCGGAGGTCCTTGCCGGTCGAGCTCTCGCATTGGTGGTC
GTCGAGGAAGCGCAGCACCTGGGCGATGTGCGCCAGCTTCTCCTCGTTGGTCAGCAGCACCTGCGACGCAGCGTCTTGCTCTCCCTGCGTTGCTTCGTCG
TCTTCGTCATCGTCTGGCTCCTGTTCGGACTCGCACTCTTTCTGGACCGCACAATTCACAAAGTCCTCGTCCTCCACGCCAGCGTGGATGCTGTTCTCAT
CCTCCGGGCTCAGCAGTTCGTTCATAGACATCGGGTTCGCGACGCCCAGCCACTCGATATGCTTGGTGATGTCGTCCTCAATGTTCTGCTCTTCCTGGCT
CTTCCGTCGCTGCGCGACACTCAGCGGCTCACCGCCGCCAATCAGACGCGTGCGCTGCCAGCAGTGGAGAATGAGCTCCGACGAGAGCCCCTCCCAGCAC
TGCTTGCTCCATTTCATCGCCTGCAGCTGGTCGACAGCGTAGATATGCTTCTCGCCCTGCTCGTATCGCTCCAGTGCGTGCATCAGGTGCAGACGTCGGT
ATCGGCGTTTGAACGCAGTGATGATGCCGGCGTTCAGCGGCTGCAGTTGCTCGACTCCGTGCGGTGGTAGGAATGCGACGTTCACGTGGTCGAACGTCAG
CCCCGTGACCACGTGGGACGACGCTGTGTCCAACAACAGCAGCACGCTCCGCCCTTCGTCACGCATCTTCATGTTGAACTGTTGGAGCCATCGCTGAAAC
ACCGTCTCGTTCGTGCACGCCTTCTGATTGCTCTCGTAGCGCAACTCCAGTTGCTGCGCGGTCTGGCCCCGGAAGCTGCGCGGCTGCTTCACGCGCCCCA
CGAAGAGCGGATCGATCCTGTCGCTGCCGTCTGCGTTGATGCATACGGCGAGCGCGAACCGATTCCTCTTGGCGGTTGTGGTTCCAGTAGCAGCAGCAGC
AG