Description :
From Genome Similarity Track
Location :
contig_32:446988- 448262
Transcript NameFunction/comments
g7365.t1OWZ11548.1 hypothetical protein PHMEG_00015417 [Phytophthora megakarya

Sequence
1274 bases(100 bases per row)
TCGTCTTGCAACGCCCGTGACACTTCGGCCATCGCCACGCAGGACGAGAGCTTCGTCGCCCAGAAGGCGCGACCGGACATGGCAGCAGCAGGTCGAGAAG
ATTTGTCGCTCCGCTTCCCCTGCTTCACCAGCGCGTAGCAGTCGAGCGACATGAGGTGCGTCTGCAGCTCTTCACGGGATAATCGAGGCACCCAGGCGGT
CTGAGGGAGACCACGAAAGCGCGCCAGCTCCTCGCTGACTTGGTTCATATCGCACTGGTGCGATCGCTTGGTGCCGTCGTTTTCGTTGCTGCCGGGGCAA
GTGACGTGATCACGTACAGCAGCAGTTTCGCTTGTCTTGGTAGCTGCTTGATTTGCTGGACAACAGGGGACGAGAGCATTGCTGTAGCGCACTGAAACAC
GTCGCGCACCGTAACCTTCACAGGTGCGGCCGAACCCTCCAAAGCTGAACAGCTGACTGCGCCCGAGCGTTGAAGCGCGTGGCGGGCAGACTGCTGCAGC
AAACTGATGGCCAAGCGGGCGTCGCCATCTCGGGCTGCCACCTTCCTGGCAATGAGCTCAACAGCGCGAGGCTCAATGAACCTGGCCACCTCTGAGCTGT
CGGAACTTGACGCTCTCTGCACATAACTCTGCAGAATCAGCAGCAACTCCTGGTGCGAGTAGGAGCCAAAAACCACACGAGGGACCCTCGAGTCGTCAGA
GCCTTCACCGGTAACATGAACGCGGGACACCTGCTCGTACATGTCGACGCCGTTCATGATGCCCAAGAACTTGACCTCCGCAGGTGTCACATGGGCCCAC
CGCACCAAGAAATGGAGCAGCTCCTTCACCCTTGGCTGCATCCGCGCAGGAAGCCGCAGCAACTGGTCCACCTCGTCCAGCACCAGCACCACCGAGCGCT
GTTTCGCCTTCACACCGCGCTGCATTGCAACAAAGCTGTCGAGCGCGTACGGGTCCATCGCTTCAGGTACACTCCAGCTCGTAGTTTGACGCACCTGCTG
CGCCACGGCAGCGTACAGCGCCGCCGGATCCGTGAACGTGCTGCAGTTGAACCTGACCGCTGTCTTGGCGCCTTTCCTGGTTCGTTTCCGGTTCGTTGGC
GATGCAATTGCCACTGTCTCGTATCCCTGTTCTCTCAGCAGCTCATTCACCGAAGAGCTCTTGCCGGTACCGGGGGGTCCGATGATGAACAAACTGCCCT
GTGCGTCTCCCTTGAGCACTTGACGAACAACCTCGTGCTCTTGTGCACGGCCGACAATGGGCGAATCAGCGCGC