Description :
From Genome Similarity Track
Location :
contig_2:446965- 448635
Transcript NameFunction/comments
g598.t1hypothetical protein

Sequence
1670 bases(100 bases per row)
ACCTGGACAACGTGGCGGAGATGGACAACCTGCATGAGGCGCCGCTGCTGGACCTGCTGCGCCGCAGATACCTCGAAGACAAAATCTACACGTACACGGG
CGACATCCTCATCTCCATCAATCCGTACAAGAACATCCCCATGCTCTATAACTTCCCGGAACTGGACTCCATCGGCAAGCTGGACAACCCCGTGCCACAT
GTGTACTCTACCGCTCACGGGGCGTACCACGCCCTGATGAAGGACGGCAAGTGCCAGTCCATCCTTGTCTCTGGCGAGAGTGGAGCCGGCAAGACTGAGG
CATCCAAGTACATTATGAGGGTGAGCTTGAGGTGTTACTATTGTGGTGGTAATTAGTTCTAATGGGGTGGTGCATTGGTTTTGCTGCTGCAGTATCTGGC
CAATATTTCAGAGATCGGGAAGAAGACACCCAAGGCCCCTAAGACGGACAATGGTGGGTCATCGGTGGAGCAGTGTGTGCTGCAGAGTAACCCGCTGCTG
GAAGCGTTCGGTAACGCCAAGACGATCCGCAACGACAATAGTAGCCGATTTGGCAAGTTCATCAAGATTTACTACAATGCGGACGGCACGATCTCGGGTG
CTACAACGAGCCATTTCTTGCTGGAGAAGAGTCGAATCGTTGGCAGTGCGGATGCGGAGCGAAACTACCACATTTTCTACCAGCTTTGTGCGGGGTTGCC
TACTGAGGACAAAAATGCGCTGAAGCTGAAGCCTGCGAGTGAGTTTCACTTCTTGAACCAGGGCAACTGTATTCAGGTGCCGGAAATCAACGACAAGAAG
GACTTCAAGGAGCTTGTTGAGGCTATGGGAACTGTTGGTATCCCGCCAGATTTGCAACATACTATTTTCCGCCTGGTTGCGTGCGTGCTGCATCTTGGTA
ACGTGGAGTTTACGGAGAATGCCAAGAATGAGTCCGAGATTGCCCACCCGGAAGATGTCACGAACCTCGCGGAGCTGATGATGGTTACGCCGGATGAGCT
TGAGTTTGCACTCACCAAGCGAACGATGTCTGCTGGCGCGCGTGGCTCAGTGGCTGAAATTGCACTGACTGCTGTCGAGTCTGTGAAATCGCGTAATGGT
CTGGCGAAGGATATCTTCAGCAAGATTTTCGATTGGCTCGTGTTCCAAATCAACAAATCCACTTCAAACGTCGGCGGCAACTCGGGTGTGGGTGCGGGGT
CCAAGTTTATTGGAATCTTGGATATCTTCGGTTTCGAAAGCCTGCAAGTAAATTCGTTCGAGCAACTGTGTATCAACTACACGAACGAAATGCTTCAGCA
GCAGTTTAACCAGCACGTGTTCGTGTATGAACAGGAAGTGTACGTCGAGGAAGGCATCGACTTTTCTCGCTTGGAGTTCAAGGACAATGGACCGTGCCTG
GATTTGATTGACAAGAAGCCGCTGGGTATCCTGCCGCTTCTTGATGAACAAGGAATGCTCGGTCGACGCGCAAGTGACGAGAACTTTATTCAGAAGTTGC
ACCAAACGCATCTATCAAAGGGCAAGGTTCCTGAGGGTACTACTATTTACTACTCAAAGCCACGATTCGCCACGGATGAGTTTGTAATTCACCACTATGC
TGGTGAAGTTACGTACAATGTCGTTGGTTTTTTGGAGAAGAACGATGACTCGCTGCACAACGATCTGATT