Description :
From Genome Similarity Track
Location :
Scaffold_259:44693- 52810
Sequence
8117 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAAGGGACCTGTGAACTGGCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCCCACTTGGTAGCACTTGTTGGTCAATCCACGCCACCGCGGGTAGACT
ACCTGAACCTCTCCGAAGCTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGCTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCG
GGATGGAGGTCCTGCAGAGCTTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGT
GCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGCCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAAC
CTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGCGTTGCTTTTGCACTCTCCAACCTTAGCGGCC
GTGCTAAGAGTCGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCATTCCTCCCGGC
GAACTACGAGTACCGCCAGCTTCCTCGCGTGTAAACAAGGGAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGG
AAACCCACTCAACGAACACATCAAGATGAATGTGTTCATGGACGGCCTTCGAGTCGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTT
GAAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTTGGAGTTCCTTGTCGGCTCCCAGTCGA
ACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCCGCTGTGGGAAGATGGGCCACTTCAAGCGTGACT
GCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCA
GTAGGGGCGGGGCGCCCTACTGGGGAGGAACTAAGTCTTCGAGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTC
TCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAA
GAATTTCGCACGCCGCCAGGCGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCC
GACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATC
CATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGA
CAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACTAAAGCATCCGGCAGATGCTTGGGAGTCGTC
GACGTATATGACGACTCCGAGGATAGTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAAATTAGGTCCACAGGTGGGTAACTTAGTTC
CGCAGACAGCTGCAGCTGTCATGACCACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGG
CGCTGAACACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACA
ACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTTCCCGTCACAGACGCCGTCGGCAAAGAC
GCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGA
AGAGTGCTATCACATCTTCGATGGTGAGACGGGCTTACCCGTCAAGGCATCTGGTGCCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTC
GAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGAAAGATTGCTGAGATGGTACTCATACGACCTAAGACCACTCAGGAGGAGCTGAACT
CCTCCTCTGTCTTGGACAAAAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTGTGAGATTCTTAAGAACCCCAAGGATCCGGTTTA
TCCTTTGGTGACGAAGTGTGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGC
ACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGG
AATCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAACCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAGCAACGCAACGGT
GCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAA
ATCCTGATGCGCGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGATCGTCATGCCGCAGGGCTTGTCTAACGCCC
CGGCGACGTTCAATCGCGTGGTGACGCAATTGTTCCGCCCTTTAGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGG
GAGGCAAGACGACCATGGAGGTGCATCTAGGACACATCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGCCAAGTGCGTTTC
GCGTTACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCC
GATCCCAGAAGGATCTTCGAAAGTGATTGGGCTTGGCCAACTACCTTTACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCT
TCATAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGAC
GAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCAATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGAGTCATCTCGT
TCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAAAATGCCCTTGTGAAGTTCCGTGTTCACCT
TCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCC
TTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACA
TCACGCGGGTGACAACGGATCTATATGATCGTATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCATCAAGTTCCTTAAGGCCGGAACGAG
CGCGAAGTCCGACTGGCTTTCGTCGCGACAGCGCTCACGACTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTGGAGCCCACTGATCCT
CCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCT
TTCTGACGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGG
GCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGGTTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGC
AACACCGGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATAATACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTC
GTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGAACCGAGACCCGCGGTTCACTGCCGCGTTTTGGAAAAACGCTGTTCCCTTTA
CTGGGAACTCGTCTGCAGATGTCCATCGCGGACCATCCGGCAGACAGACGGCCAAAACAGAGCGCGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTACACGGGGTTCACGCCGTTCTACTTGAACGGCTTCC
GCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTACTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGT
GAGACCAGTTTCGCTGCGAAAACAGGTGGAATCCTTTATGGACACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAA
CAAAAGGAGTACTCAGACAAACAAGGTAGAGGAAACTTAAGTATATTTGAGGGTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTG
TTAGCTCTGTCGGTAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTC
AATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGCCCCAGCTCCTCGA
AGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGC
TCCATACGAACGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGAC
GTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACTCGCAGGTGCACTCGCGACCTCTC
GCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTC
AAGCACGAGGATACGTTGACGGAGACGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAG
TACTCGTACTCGTACGAGGGCACCTCTGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGC
AAGCGACAGCTCCTCGTGAAGTGGAGGGATTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAA
TCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTTTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGA
GCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGTTTGCTGCTCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTTCAGGATGTGGG
ACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGG
ACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATG
CGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTCGAAGTGT
GGCCGCCCAGAAGGCCACGAGGAGCGACGAGAACCGCCAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGC
TCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGACAGCTTGGAAACCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGC
TCAACGATAGCACCCTCCTCCTCCTCTACTTCGTCCTTCTCCTCCTCTTCATCGGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCT
CGCGGAGTGGAGCCTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACG
TTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAACGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCA
CCGTGATCACTTGCGGGCGACTGCACGGTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCT
CGGACTCGGCATCGTCTTCACTGCCCGAGTTGAGCTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCT
GCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTA
GTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCT
AGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGA
GAGTTTGTGACGAGCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGCTA
CATGAAGTGTGACACTTCACACTCCAGGACTATGACACGTCATACTCCGGGATATTTGGTACAAGGCACCAAGGTCGTTCAAAGCCAACCATTGGCTAAA
TGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTATTAATAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAG
GTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTG
TGTGACCCCGTCACATA