Description :
From Genome Similarity Track
Location :
Scaffold_163:44684- 45852
Transcript NameFunction/comments
Phypl_g4513hypothetical protein PHYSODRAFT_260330

Sequence
1168 bases(100 bases per row)
ACACGTTGGCAAGCTTAGAAGCGCATGTCGTGGACGCGGTCATTCTTGGTTAGCGTGAACTTGGCGTTCAGGTACGCGCGCAGATACGGCTCgttcgcca
gcttctgcatcaACAGGGCGTCCACCGCCTTTTggtccttcttgcgctgctccgcAATTACTGGCGCTGTCTGCGCAACACAAGAGCCAGCGTCAGTACA
ACGGGTGGAGGAACTTTTGCGATCCCAAGCGCACTTTGCAAACCCCACAGCCACACCCTTCGGCTCTCACAGGGACCACTCACACACAGGATCGCAATTC
AGTTCAATCGTCAACGTACCGGCGTTTGCTGTGCCGCAAAGAACCGGTCCtccttgctgctcttcttggctggCTTGTCCTTGGTGAAGTACTCATCGTC
GATctccggcagctccacgtccgacAAATCCATCCGCGTGGACGTGGCAATGACAAAAGCCTGGTTCACGCGACGCAGTGGCACACCGTTTACTTTATAC
GGGCCTGCATTGCACAGACAACACATTAACCTGTTAGCACCACTGCTCGTAGCAACCAAGAGCCGGCATTCCTAAGGTATCATAAACTGATGGGTCTTTG
GCAAGTAGCCACCCTTCCCCGTCCACCCAAACCCCCCTCGGGGCCACGCATGTCCAGGGCCGACTGCCTCCGTAAGAGAAGACAAAGGATGTAGCCAGCC
ACGAGACACGAGACGAAGGGACCAGAGACGGACGTAAGAGGGGGCCGCAGAGCGCCTCTCGAAGTGTCAAGTTTGCATCACCGGAATGCCATCTCGGATG
GGGGTCTCGTAACTTTGACTCACCCGTGACCAACAGCGTGCCCGACGGCAGCTGCATGAGGAacaccacgcgcttgccACGGAAGCGTCCGGACAGCAGG
ATGAGCACCGTTCCGGGCGTAATGGACTTGCGTAGCTTGGCGGTCTTGACGCTGTTGCGCTTGGTCTTGGCGGACGACAGCGGCTTGGGGATGTAGTCAG
CCGAGTACCACTTCTTGGTCAAGTGCGCGGGCTGCGAGGGGGCCTTCTgggccttggccttgccgaTGGTGGCGCGGTGGGCGAACACGCGGCTGTTGGT
CTTGGCCAAGCTGTTGGCGGagatggcgttgatgccTCGCGCCAGCTCAAAGTTGGCACGCTTCTTGG