Description :
From Genome Similarity Track
Location :
contig_32:446795- 447865
Transcript NameFunction/comments
g7720.t1RAW32297.1 hypothetical protein PC110_g11362 [Phytophthora cactorum

Sequence
1070 bases(100 bases per row)
TCGTCTTGCAACGCCCGTGACACTTCGGCCATCGCCACGCAGGACGAGAGCTTCGTCGCCCAGAAGGCGCGACCGGACATGGCAGCAGCAGGCCGAGAAG
ATTTGTCGCTCCGCTTCCCCTGCTTCACCAGCGCGTAGCAGTCGAGCGACATGAGGTGCGTCTGCAGCTCTTCACGGGATAATCGAGGCACCCAGGCGGT
CTGAGGGAGACCACGAAAGCGCGCCAGCTCCTCGCTGACTTGGTTCATATCGCACTGGTGCGATCGCTTGGTGCCGTCGTTTTCGTTGCTGCCGGGGCAA
GTGAAGTGATCACGTACAGCAGCAGTTTCGCTTGTCTTGGTAGCTGCTTGATTTGCTGGACAACAGGGGACGAGAGCATTGATGTAGCGCACTGAAACAC
GTCGCGCACCGTAACCTTCACAGGTGCGGCCGAACCCTCCAAAGCTGAACTGCTGACTGCGCCCGAGCGTTGAAGCGCGTGGCGAGCAGATTGCTGCAGC
AAACTGATGGCCAAGCGGGCGTCGCCATCTCGGGCTGCCACCTTCCTGGCAATGAGCTCAACAGCGCGAGGCTCAATGAACCTGGCCACCTCTGAGCTGT
CGGAACTTGACGCTCTCTGCACATAACTCTGCAGAATCAGCAGCAACTCCTGGTGCGAGTAGGAGCCAAAAACCACACGAGGGACCCTCGAGTCGTCAGA
GCCTTCACCGGTAACATGAACGCGGGACACCTGCTCGTACATGTCGACGCCGTTCATGATACCCAAGAACTTGACCTCCGCGGGTGCCACATGGGCCCAC
CGCACCAAGAAATGGAGCAGCTCCTTCACCCTCGGCTGCATCCGCGCAGGAAGCCGCAGCAACTGGTCCACCTCGTCCAGCACCAGCACCACCGAGCGCT
GTTTCGTCTTCACACCGCGCTGCATTGCAACAAAGCTGTCGAGCGCGTACGGGTCCATCACTTCAGGTACACTCCAGCTCGTAGTTTGACGCACCTGCTG
CGCCACGGCAGCGTACAGCGCCGCCGGATCCGTGAACGTGCTGCAGTTGAACCTGACCGCTGTCTTGGCG