Description :
From Genome Similarity Track
Location :
Scaffold_34:446783- 452021
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011038Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
5238 bases(100 bases per row)
AAGTTCCTCCCAAGTCTTCCTCTCAAGCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTCGTAGTCCTTTC
AACGACCACGTCAAGAGTCTGCATAGGCCGCTTGTGTAGCGTGCGCAGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGGATTGAGACG
CCGATGGGCTCGATGCCTGGAGAAACCGTGGAGCTGACGAATGAGCATTTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGG
TCATCGGTGAGGCGGCTGTGATCAGCTTGCTGAAATCAGCGTCACCGGTTGAGCAGAGGAACGCGGCTACGAGCTTCATGCATCACGAGATCATGAACTC
TCATCGACAGTCTGCAACTCCTGTCACGACGATGAGAGTAGCACCTCTGAAGCTCGATGTATCTCCGTACCGTGGCGGAGAGAACGAGCCTCTAGCGAGA
TGGTTCGTTGAGTTGGATGCAGCGATCACTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTTGCAATGTCAAAACTTGCGGGTCGAGCGAAAA
GTTGGGCGTATGGGAAGCGATTGGCGGAGCCACATTGCTTCTACGACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCGCAGAGCGA
ATTTCGGGCTCGCGCAGAGTTTTTAAAGCTTCGTCAGGGTAAATACGACCTACACTCGTACGCACAACGAGCTCGCTACTTGGTATCGAGCATCGTGGAC
GAGCCGATTGACATCCCAACGCAAGTCGTGACGTTCATGACAGGTCTGAACGATGGTCCGATTCGGAACCAGCTGTTCCGTGAGTACCCGAAGACCCTGA
AGGAGCCATCAGCCGTGCGATGCAAGAAGAATTCAGCATCAAGCAAGCCAAATTCCAAGGTTTCCGGCAAGACCACCAAGGCAACCAAACGTTGTTCATG
ATGGCCCAGAGCCGATGGACATCTCGTACATTTCCACGCCTGGAAATGAACGTCCTCGCAACGATGGAAAGTGTTTCCGTTGTGGGAAGCCGGGTCACTT
CGCTCGGAACTGCAAAGTGTCTTGTCTGATCGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGACCCGTATAATGGTCGTCGGTTCGATCGTTCCCA
AAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCTACTGGGCTCGAGAAGAGGACTGTGAATGTTGTGGAAACACAGGACTCTGGCCCCAATGT
GCATGATGCACATGCAGTTTCCACGAGTGAGAAGAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCTCTA
CGAGCTTTGGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATTGCCAGGCACAACATCTCTGTGCCTGTTGCAAATGAAGAGAAGACGA
TGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTCGTTCGCTTGGCAATGAAGTGTGAAGATTTCCGAGGCGAGGACGAGTTCAT
CCTTCTCGACCTCGATGACAAGTTTGACATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACATGAAAATCTCCGTT
GACAAGTCATGCAGCGCTGACTTGAGCAGCATGACAACGGATGAAGTGGTATGGGTTTATACATCTGTGGAAGAAATCTCAGATGGCCCTTGTGATATTG
CGGTGTGCGATGGCCCCCCATGTTCACAAGTGGCACCCATTTTGAAGAAGACAAACGGAGGTGGAGCAGTCAGGCGCCAGAAAAAGACTGTCTCCTTTGC
CATCGACGACAAAGTTGCGTGCGATGGTAGTATGAAGAATGACGGGAAGATAGGCAGAGACCCGCCCCAAGACAAGAAAAAGAAGACCAGCAAGAAGAGT
GTTTCATCAAGAGTTTCAAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCAAGAGTCACTTCGAGCGAATTTGTGAATATCG
CGGTCTGCAAGGAAGAAGGTGACGTGAATGTAATCCGTCACGTACAAGTGGAAAATCCTCCAAGTTCTGTCCAAGAATTGATTTCCTTGCCATCGATGAG
CAAGAAGACGCTGAAGCGTAGCCTAGCGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGGCGATGCAGAGGACATCAGCACAGTATCAGCA
ATGGAAGCTGAAGTGCTTGATGAGAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCATGGGACGCTCTCAAAACCAACCCCGTGTATGCACTTGCCAGGG
AATTTGAAGACATTTTCCCAGACAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCACGAAGTACTGCAT
CACAAGACAGTGGCCGTTGCCAAAGGAACAAGTCGATGCGATTGATGAGTTCTTTGCGCAACGTGCAAAGGCTGGCCATGTGCGAGAGAGTAAGTCTCCG
CATTGCAGCCCCACTTTCTGTGTGAAGAAAGCAACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACCATACCTGCTCAAACTC
CGGTTCCACGCAAGGACATGATCCTTGATGGAATGGTTGGCAGCACCATCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCGCGA
AGATGATGTCCCACTAACTGCAGTGAGTACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCTCCTGCGACCTTCAAT
CGAATGGTCACGAACGTTCTTCGTCCTTTACGAACATTTGCACCGAGTTACTTTGACGATATCTTCGTTCATAGTAAGGCCACGAATGGGAGATCTGATG
TTGATGTTCATCTTGATCATCTTCGTCAAGTTTTCCAGGTCATGCGTGAAAACAAACTGTACGCAAACTTGAAGAAGTGTATGTTCTTCGCTCCCGAGAT
CCCTGTTCTCGGTTGTTTTGTGGGCAAGAACGGTGTTCGAGTTGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGAGCCAAAGAACGTCAAACAG
CTGAGACAATGGTTGGGTCTGGCCAATTACTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCCCTCACACAGCTCTTGAAGAAAGACGTGA
GTGGAGTGGTCGAAAGACCATCAACGGCGTTCGAGAGTCAGAGGAGTCTCGTGAGCTCCTGTGTGGCTTACCGGACCACGACAAGCCGTTCCATGTCGTC
TGTGATGCGAGCGACTATGCCATCGGTTGTGCATTGATGCAACACGATGATGAGGGTCGAGAGCGAGTTGTTTCGTATCAGTCACGACAACTCCGACCCG
CAGAACGGAACTACCCAGTTCATGACAAGGAACTTCTGGCGATGAAGTATGCTCTTGTCAAGTTCCGTGTCTATCTGCTTGGCGAGGAGCGCTTTGCTAT
TTACACTGATCACGCATCACTGCGGACAGCGGTAAAGACTCCTCACTTGTCGCAAAGAAAGGCGAGATGGCTTTCCTTCTTTGCAGAGTACAACTTTGTT
GTACACTACAAGCCAGGCAAGACGAACATCTTAGCCGACGCATTGTCAAGACGTCCGGATTACGATCCGAAGTCCAAGAGTGACAATCTGGACGAAGAAT
GTCGACTTTGCGAAGATGTTCAAGCGATCGCAGTTCAAGCCACGACGACAGTGCGAGAAGAGATTGTCGAAGGGTACAAGTCTGACGACACATGTCAGGA
CTTGTTGAAGTACTTCAAAGATCCTTCGGGCAAAGCACTGCAGAGCTTGCCTGCTCGAACAAGATCGCGTGTTCACCGCTTCCAAGTACACAATGGGTTG
TTGTACTATGCGGTTGAAGATGGGGATACAGCAAGGGTTGTTGTTCCCAACGACGAGGGCCTGCGTCATCGACTCTTGTATGAGTATCATGACAGTCCCT
CAGGTGGTCATCTCGGACGTGAGAAAACGTTTCTCAATCTTTCCCGGGATTATTACTGGCCACACATGTACAAGTGGGTTCGCAAGTATGTGAGGACTTG
CGAAATCTGCCAGCGTGTGAAGCCCTCTGGCTCCACACAAGCCCCACTTCGTTCATTGGCAGTGCCAACTGACAGCTGGAAGTCCGTGAGTATGGATTTC
ATATTCGGACTTCCAAGGGACAAACACAGCAGAATGGCATCCTGGTGTTTGTGGACCGATTTAGTAAGATGGTGCATCTTACTCCGGTCTCTGACAAGAT
CTCGGCAGAGATGACTGCGAAAGTCTTTGTAGACGTGGTGTTCCGTCTACATGGTCTGCCTTGGGAGATCGTGTCCGACCGAGACACTCGGTTTACGTCC
AGATTCTGGCGTACTCTGTTTGGCATTTTGGATACGAAACTATCCATGTCAACAGCAGCACACCCAGAGACAGACGGTCAAACTGAACGAGTGAATCGTG
TCCTGGAAGACGTGTTGCGCAGCTATGCGACGTCTTTCGGAGAGTGGAGTGAGTTTCTCCCTCTCGCTGAGTTTGCGTTGAACAACTCCACGCATGTCTC
GACAGGTCATACCCCGTTCTATGTGAACTACGGACTCCACCCGAGAGTGCCAGCGTCACTAGTGGGAGAGGTTTCTACCTTAAGTGGGGGAGAGACTGCG
GCTAAGGAGCCACAGTCGGACCTGAATGCTGTCACAGAGTTAAAAGCGAATTTTGACTCGATGAAACCTCTAAACGACATGACAAGTCGTGAGGCACAGC
AAGTCGATGACTTTATTGTGAGGAGACAAGCCATTGTAAGGTTTGTTCGAGACGCAATTGCAAAAGCTCAGGATCTGCAAAAAGAACAAGCAGACAAGAG
TGGAAGGAAGAACAAGCAAGTATATAAGATTAATGATCTTGTATTACTTAGTACGGCTAATCTGCCTGAACATGCAGTGTCTAACTTGGGGAGTTCGAAA
CTTCTGCCAAGATATATTGGGCCATTCAGGGTAGTTAAATGCAATGGGGATGCATACACACTAGACATTCCTAAACGCATGCGACTACACCCTACGTTCT
ACGTAGGACGATTAAAGCCTTACCTTCCAAGTGGGTCA