Description :
From Genome Similarity Track
Location :
Scaffold_1361:4466- 6085
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1361-snap-gene-0.3GTP-binding protein

Sequence
1619 bases(100 bases per row)
GCCAAGATGAAGAAGAAAGTGCGACACCCTCATGCGCGCTACAAGCGTCTCGTGGACGCTCTCATTGCATGTATATTGAACTGATGTTGTTGTTTTTGTA
TGTGTGTGTATGCGTGTGATTAGGTGCTGCTGATGGGCAAGTCCGGATCCGGCAAGACGTCGATGCGATCCATCATCTTCGCCAACTACCTTGGTAAGCG
AAAGCGAGCAATATGCTGCTTAGGCAGCGGTGTTTATTGACGCAGTAATAGTAGTTGGTAGTTTGATTGTGCCCTTTTCGCCGTGCTGTGCTTCATCTGG
GATGTGATGTGGGGTCTAATGTACTGTTGTGATGCTGGCCGTCGTAGCTCGTGATACCATGCGCCTCGGACCAACCTGTACGTAGGTCCCATGTTATATC
TCAAATATATAAATGAGATCGACCTGGTGCTTTTGAGGAGATGATTACTGATGACACGGCTACTTGTGCACGACGCAGTGGATGTGGAGCACTCGCATGT
GCGATTCCTGGGCAATCTGGTGTTGAACCTCTGGGATTGCGGCGGGTATGTGACGGCGCTATTTGTCGCGTTTTGCTGTTGGTGCTGTGTTTTTTTTCAC
GCTGTGTATTGTTGTCAACAGGCAAGATGCGTTCTACGAGAACTACTTTGAAAGCCAGCGGGACCACATTTTCCGCAGCGTGGAGCTCCTGATTTACGTG
TTTGACATTGAAAGCCGCGAAATCGACGTACGTACGCATTCGCTTGTTGAAGTGACGCTGTGCTCTGTGGATACTAATGTGAACGATTCGGTGCGACAAC
CCTTGTAGAAAGATATGGCGCACTTTGACGGTTGCTTGGAAGCGATTGACCAAAACTCGAGCAATGCCAAGGTGTTTGTGCTCATCCACAAGATGGATCT
GGTCCCAGAGGAGCAACGGGAACGCGTACGTGGGGCTTCATCCTTGTTTTATCGAATGCATTGGGGCACAAAGCTCATATCGTGTGTACGATGGTTATTA
CTTCTCGCTACATGCAGGTTTTCGAGCAAAAGAAGGAGATGATTCTGGCTCGAACTGGAGCGTTGCCGACGGTGTGCTTCGGCACATCGATCTGGGACGA
AACACTGTACCGTGCGTGGTCGTCGATCGTGTACTCGCTGATCCCAAACATGCAGGACCTCGAGAAGCACTTGAACACGTTCTGTTCGATCTGTAACGCC
GACGAAGTCGTGCTGTTCGAGCGCGCAACGTTCCTCGTGATCTCACATGCCACGCATGCAAACCACCGCGATATTCACCGATTCGAAAAGATCAGTAACA
TCATCAAGCAGTTCAAGCTCAGTTGCAGCAAGACGCAGGCCCAATTCCAGGGCATGGAGGTCCGCAACTCGAACTTCACGGCGTTCATCGACTTTTTTAC
GACCAACACCTACATTATGGTGATCATGTCGGACCAAAACATCCGTACGATACCTCTGACTTGCTTATTGCTCCTTTGCTCCGATAGGATGCACTGACGT
GACTTATCTCCTTTGTGTTGGACTGTTGCTCTTTTACCACAGAACCTTCCACGATCCACCTTAACATCAAGGCTGCTAGACCAGTGTTTGAAAGCTACGT
TCAGCAAACAAGTTAAACG