Description :
From Genome Similarity Track
Location :
scaffold_135:44651- 46617
Transcript NameFunction/comments
g4352.t1 RWP-RK domain-containing protein, putative

Sequence
1966 bases(100 bases per row)
TCCAAGTGGCTGTGAAAAGCTACACGCCTTTGTCTTGATCTTGATGAACCACAGCGAGTGTCCACACTTTTATCGCGAGCGTCTACAGCATCAGTCGCTT
GCTTCTCTCACCATCGAGACGATCTCGACAATAACAAAGAAAAGACCTAACAGAGGCGTCGTGGTGAAGGGTGGGTGGGGCGGACCTCAATCCTCAGCGC
GCGCGTCGCCTCATTCTACCTCATTTGCAGTTGCGAGCTGTCCGACGAAGCCCGTCCAGGACCCGGAGACACAAGTACCGCGTGCCATCCCTCTGCTCTC
TCCACTGCAATTTGCATTCCCTCTTTCGAGAGAGAATTCGCGATCGCTCGACAAGCTTCATCAAGGGACTCGGAGCTGCATCGTACAGCGTTGGAGAGGC
AACCAAACGGCGTGGGACCAACGGGAAAACGCACACAAGCACGCACCGACAACAACGCACATCAACACGCCCGCTACGGATCCCACTAGCGAGGGGGAGT
ACAGTGCCCACTTCTCCTTCATTCCGACATCTATCCCGGATAGATACAAGCTCTCTTGCTCCGCTGGAAGCCAAATCTCCGTAGACTTACTCAACGCGTT
GTTAACGCCAACCGCTTGAGCTACCGTGAATGCCAACGTGGACGCCGGTGATTAACCTTCAGCCCCGCCTCAGCATGGAGCCCACGGAAGAAGAAAGCCG
TCGACGGAGGCGCCGAATATCGGTTGATTCACCGCAGTCAGTTCCAGGGGAGAACACGGAAGCCCACGCCTCAAGTGAGACCATAGACCGTGGATCATCT
GCCGCCGTCTTAACTGCATCCGAGAACCACATTACCTCCCTAGCACCGCTTGGCCAGGACCAGGTCCAAGCGCAACCTCCAGCCGAAGCACCACCCGCGG
GTATTCAGACGCGACACACAGGCAAACGACGGGCTTCGGGCGAGATGATCCGCCGCGAACAAGAGTCCAAGGCCACGCAACCGACCGCCCAAGGTGACGA
GATTCGACGCCCAGATCTTCCGGAGCGGGCGGTGGTTTCGCCGCACATTGGTCGTGAACCACAGCCGCTCTTAGCGCACGGGAACGGGCCGGCTGTAGCT
GCGACGCCTTTGGCTCTGCGGGTGTCGTCTCGACGCACTACGACGACGACGAGATGGTCTCCATCGATGGCTGGCGGCCGGGACCAGCGCATATCAAGAG
CAGCTTCCCACCGGCCACGTACGGCGTCTGGAATGTCGGTGACTCCACCCGCTCGTCCGATCTCGAACGCCACGCGGAACATCAACTTCGACATGCTGCA
GCCTCATTTCGAACGGCCTCTACAACAGGCCGCAGACAGCTTCGGGGTGTGCACTACCCTCTTAAAGAAGATCTGTCGAAGGAACGGGATCAGCAACTGG
CCGTATCGCAAGATCTGCGGACTCCGGAAGAGCATCGCGTCTATGACAAAGCAAGTGAACTACTTCGACGGAGAACAGAAGCGCGCGTACGCCGATCAAC
TGGAGAAGCTTGAGCACGAGTTACAGGCGTTTTTACGCACAGGAAACGAGCCGACGGAGGAATTCCTACGGAAACTTAAAGCAGAAGCCGCCGCTACTGC
GGAGCAACAGACTGTAGCGATAGGCAATGAGGATGAGGAGAAGGAAGCGCAGGTGGTTCCAGCGTGGACGGCTAGGCCCAGTCTTGCACCGCCTCAATAC
AGCGGCGCTCAGAACGAACTGCAGACAACCCCTAGGCACCTTGGAATGAGCCTCAACACTTGGAGTGAAGCCCATACGCACCACTTTCCTACGATCGCTA
CGCACCACCGAGCTCTGCCGTCAATCGCCTCTATCTTACAGCACCAGAGCTACTCGAGTCCGAGCCGAGCAGCCTCGACGCAGGACCCACAAAGGGCTCA
ACAGCCAACGCAGTGGAGATATTTCCCTCCAGCCAACGACGACGCAGTATGATATCATGCACCAGA