Description :
From Genome Similarity Track
Location :
Scaffold_212:44647- 50227
Sequence
5580 bases(100 bases per row)
GTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCA
AGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATG
GCCCAAGTACTCCACCTTGCGCATCCCCCAATAGGTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCG
CACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCCCCCCGCTTC
GAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATTATCGATCAGGCGTTGGTAGATCTGGGGT
GCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGGGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCC
AGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGT
CAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAA
CTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGT
CGCCGACATCGATGTCACATTTGACCCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAG
ACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGGATCACCGCCATGCCTTCTCCC
AGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGTCCTCTCT
TGCCTGGCAGTCCTTCTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAG
TTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCG
GCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACTTCCATTGCTTGGA
TCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATAAAGCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCG
ATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCA
ACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTAGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGT
AGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTA
GTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCG
CCAGATCCAACCTCACTCCGGCCGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCAAGATCCCCGACCCAAATGTCAAAGCAATACACCAA
ACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGG
CACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCT
TGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCATAGGA
TCCAGTGACCAGACAGATCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCC
TCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGAATAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGAT
CACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTAC
CGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCATTTTGGGCAACATCCCTCGGTGCTTGGCTGGATCAACCATTGGCGGATCTGGTT
GTAGAATTCTTCCATCGGACACTTGCCGACGTCATGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACAC
TTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGGTCCGCACTGCGAACACCTGACTTGGGCTGTCCCGTCCATGAGATCTCGGG
ATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACG
GTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTC
GGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCACCCGCAGCACTTCCTCAAACTCGTCTGCGT
CGGGAAGTCGTAGCACGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGTTCCCCCATC
CTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGGTATTCTAGCGGGGATTTGTCCGATCTGCGGCGAGCATGGTAGTATTGTCGT
GCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTTCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCC
TGGCTGGCCCCGCTAGCAGATCCGCAAAAGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCT
CGCTCGGACTTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATTCACCCGCCCCGGCT
GTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCAACATGGAAGTTGACTTCCTCCACTGACTCCATCTCCA
CGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGACCAGGAAACGACTCATCGCAGCTTCGAAGTGTCG
TTCGTTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTCGAGCCTGATCTGA
CGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGGATTGTGTCAGATCACGCGTAGGGCCTACTGTATCCCGAGCCTTCACGTTCACA
GGGGCTTCCTGTCTTCGGACCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCAT
CCTCAGCGGCGGATTCGTAGAGTGAGGACGCGGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCTCTGCTGCATGCATG
CACGACGCAGTCGTCGACGTCTGGCAAAGAGGTCCCGCGTCGCGGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCTTCGAACACACCAG
CTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTC
GATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAG
CTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCATCTTTCTTGTTTCTTCGACTA
GCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAGTCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACT
TGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCTGTCGACAGAG
TTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCA
CTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGA
TTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCG
TCGGTAGGGCGGGATCTGGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGT
GGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTG
CCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTG