Description :
From Genome Similarity Track
Location :
scaffold_28:446410- 447423
Sequence
1013 bases(100 bases per row)
GGGCTGACGTTAACGTCGGGCGGACAGGACGGGAGACGACAACCATTGCTCGGAGGTGCTTAGAGGGAGGAGGGGGGGGGGGGGGGTTGGTGTCTTGAAA
AATGAACAGTTATAATAAAAAACGGTAGAACACAAGCCAAAGCTGCAACGGTTGGTATTGAGAGGATGTATGTATCTGTATATAAGTTATGATATTCTGA
CGTCCCTCAGCATTAATTATGATATGTGATGGGTTTGGCGCTGCAATACATTTGTTTATAATATGTCCCTCAAGGGAGAAGTGGATCTAACCAAAGTGAA
GCACATGCAGAGGAATTCTGGAAGACTGACAGCTGTCCTCACAATTCGGTCTGACGGTACGTTCATTCTATTTATTTGTTTTCACTTTATGGCATACTCA
AATAAAGTAATTTTGAAGGATATAGGAGGAAAACTGCCAATACTTTCATTCTGCGAGAGATGCCTGGCAGATCTGAAAAGGCAAATGAGTTGCCAACACA
TCCAGAAGGACACGTTCACATGAGCCAAGAAAATGACTGGATGGGCGCAACCGTTTGAAGGTTTTATATGGAAAGTTTATTTAAATTTGAAATAGAATCT
CCTTCTCGATAACTTCAATTCCCATGTGTCGTAAGGGGCTGGTTCGCGTCACGCGGACTTTAAAATCAGCCGCTGGTTGAGGGTAGGGGTATGAGTTCAT
GGTTCAGTCGTTTTCCTCGATTGGCCCCGTACGGGTTCATGTAATTCACATTCAAGGCTAAAAGAGAAAAATGGACACGGGTGGCGCTCCTGCTTCTGCA
CGTGCTGCTGAAGGCGCCGCACCTCCGCCTGCTCTGAAGCTGCAATCATCGCCTCTGCTGTGACCCTTGGCAGCGGAGCTGCAACTTCCCTTCAGAGCTC
TTCTTCGGGTATGAATCAAGGTTGCTCACCACTCTTACTGTACTGTGCTAATCAATGTGAGTGTTGATCAATGTGCAGCAGGCTCGGGTAACGCAAAAGC
AAACGACGAGGCT