Description :
From Genome Similarity Track
Location :
Scaffold_667:4464- 8654
Sequence
4190 bases(100 bases per row)
GCAACGGCGCGGATGAGTCATCTGCACTCGGGACGAGCTTCTGCAACACTGCGTACACCCGCGCGAGCGTAAGGACGGCGGTTTCCAGATCGTAATCGCG
TACATCGGTGGAGATCCGGTGTTCATGTACCTTGAAACCAGCATCTTCGAGCACGGAGAACAGCATCGTGACGGCGTGAAGCGGATCTCGGATTGTTAGC
GTGCGCGGGTTGCGAACTGGACCCGTGAGAGCCCATGGCATCGTCAGCCCCAACTTACGCAGGAGCGGATCTCTCTGGAGCAGGAACGCAAGCTCTGGAC
GGAAGTAGTTGACTTCAGCTTCACGAAATCGTTTGTCTTCATCATGAGTGTCGTTGCTGGGGCCATGGACCGCTAGCGCCGAGATCTCCAATTTCTCCGT
TTTCTTCTCGGCTTTCTTCTTCGCATCTTCGACTTCCATGTAGTCCATCGCAGCGTCTAGAGCATCGCTTCGGGCAGCGGGGTCGCGGATGACCCCCTTC
AGATGCTCGCGCTCCAGGTTTCGACCTCGCTTTCAGCGACGCCGGGGTCCCGCTTAGCAGCAGGTCCAATGGAACTCGGTTTTTGGACCGAGTCCCGGAC
GGCTCCTTTCGGAGCCTTAACGGGGAACTTCTCTTCGTAAACGAAATCCTTCGGCTCAGGCGTCCCCATTGCCTGTCCGTCGGTGGACCTAGTGTTTTCA
CGTTTAACTTCCGCCGGTCCCAGCGGAGTTCCGTCTTCCCTCACCTCACCTCACCCTTCACCTTCACGTCCCCTTTCGGACTAGTAGATCCGGGCACGCG
CACCATTGTGGTGGAGTCCCTCAGATAAAAACTAATAAACTCCCACACGTGTCCTGCCACGCAACTACGGGGGGGGGGTTACCCCTGCAAGCCAAATACC
CAAAGACAACGAGAACTAGTCCCGAGATCTCTAGGCCTCACCTTGTGTACCCTTGTAGCAAGACTCGGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCGATCGCCGCTAGTATTACGCCTCGATCGGATA
TGGACGACGCGTTGATCGCGATCGCGCCGAAGAAAGAACCCCGGCGGAAGATTCAAGCACCGATCCCGACTGTACGTGCGGACGAAGAGCACCTGGTGAT
AAGTTTCGATGGATCCGCCCGCGTCAAGCGAGGCGGGGGCGCGTACAGCGCGATCTTGTGGAAGTTACCCGAATGGAGTGTGGTGAAGGCACGATCGGGG
TATGCTGAAGGGTTGACTATTAACGAGGCGGAGTATCATGGTCTGTTGTTGGGTTTCGACCTCCTTGACGGCGTAGATCGAGGCCGGTTGGTGGTCTGCG
GTGATTCCAACCTGGTGATCCGGCAAGTACGGGGCGAAATCGACTGCAAAGCACCTAAGCTGACATTGTTGAAGCAGAAGGTGCTGGACCAACTACGGAA
CTGGCCATATCACGAGCTGTTACATGTGAAACGAGACTGGAACGGGAGTGCAGACAGCCTGGCCAGTGCAGCACTCCAACGTGAAGGGGTCGTCGTCGTC
GAGGATGAGGTCGATCATGAGGATCTAGTGACACTGAACCGACTTGATGAGATCCTGGTTATTCGATCGGATGAGTCGATCGCCCGACTATCACCGATGA
CCACCCGATCGGGCGCCAGATCACGGTCGAACCCGACCGTCATGCAGGAGGAGTTCGTGCGAGGGTTGCGGATCGACCGAATTCGTCGAGCTCAAGATGA
AGAAACGTGGATCGCGGGTATGAAGAAGTACCTGATGGGAGATGTGGCTGCACTGACGCAGGATGAGGCTCGATCCTTTGGCAACCTCGCAGCGGATTAT
GAGATCGACGGTGATAATCTGCCGTTCTATTGCCCACCCTCCAAACGATCGGAGGCAGATCGAGATGGGCTGATGAGGCTGGTTGCACCAGAGACGCTGC
ATCAAGATATCTTGCATCACTATCTCTCCACTCTGGAAGGTGGACACCAAGGGATCGGGCGTACATACCAGCGGATCCGCGATCACTTTCACTGGAGAGG
TCTCTTCAGAAGTGTGCAGAAGTACGTCGGCGAATGTGCCGACTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGCCGCCGGGAAACATCCAG
GCGACATACCCGTTCCAGATCATAGCGATGGATCACATACCTTCGCTACCCAAGTCGTACAAGGGTAATACGGAAATGTTGATCTGGGTCGATCTGTTCA
CGGGATACGTGATCGCGAAGGCGAGCTCGTCCCGAACGGCGCAGACGATCGCCAAGTCTTATGAAGAGTGCGTGTTCCGGCGATTTGGTGCTAGCGAGGT
GAGCAGGCATGATCGCGAACCGGGATTTATGGCCGACTTCTTCCGCGCCTTTAACAAGATTCTGGGTATGCGTTAGCGAGCGACGATGGC