Description :
From Genome Similarity Track
Location :
Scaffold_60:44634- 46991
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_60-snap-gene-0.48Nonribosomal peptide synthetase
Pytve_DAOMBR484maker-pve_contig_60-fgenesh-gene-0.19GDP-L-fucose synthetase

Sequence
2357 bases(100 bases per row)
GTCGAGATCCGGACAGCGCGGGTGATGTTGTACGCGGTGCTCTCGGGTTGCATTTGGTACAGCGCGTACATTTGCTGTTGTGCGTAGGACAGTGGGAATC
GTCGAAGCTGGCGGGGTTCGTCATGTTGCACCTTGCTGAATTGTGTGCTCAGTCCCGGCGCGAGCTGCAGTTCGAGAACTTGTTCTTGCCGCTTCAGCGC
CGCTTCAACGCAAAGTAAAGCTTGCTTCAGCGTGCTCAATCGCTTCTTTTGTGCTGGAAGCTGCTGCCGTTGCTCGTGCTCGCTGTTGATGCTGGCTTGA
AGTCGGATGAGGTTGTGCAGCCAACTGACCACTTGGCTAACGTGTCCACCGTCCAACAGCGCCTCGATCTCCGTTCGACCACCACCACCACCACACTCAA
CGCCACTAACTGCCAAAGCGCTGTGATAACTCGGATCAGTCGCGATGACGCGGATGCCGTCGGCCACCATGGTTGCAACACTCGCGCGGCAGCAGTCACA
ACGCTGGAATCTGGAAATGGACGATCGACTTGTCGGTTGGTAATTTTCGTCACCGCCGCGGGCCGTTGTATGTAGCCGCTGCTTGCGTGCAGGCGCCTTC
GTCCCAGCCGTTTGCCCGCTCGATAGAGGGTGATGCAGCGATCGGCATCGTGCGGTCGCGATGTCCTTCGGACTTTCAACTGCTGCCGACAAGTATTATT
TTTTACCAATTGATTCGAGTCGTCACATGATATCAGCCAATCGTCAAGCAGATATTTAATTCCAGCCACCCTCGAGCTTGAATGCAAAATGCAACCGTAG
CCAAGCTTGCTTCATTCACTTGCGTGCCGAGTCGTAGTTGGCCTGAAACCACGCGACGGACTCGCGCAACCCATCGGAGAGTGAAGTGAACGCAAAGTCG
GGCACCAGTCGGCGTAGCTTGGCGTTACTGGCGGTCTTCTTGAATTGCCCGTCGGCCTTTGTCGCGTCGAAGACGACCTCTCCCTCGAACCCCATGGCAC
TCGCGATCTGCAGCGCCACCTCTCGGATCGACACCTCGTCCTGCTCGTCGACCGACAGGATGAGCGGCTCGACGGACTCGTAGCTGTCGAGGACCCAGAG
CATCAGTCGGGCGATGTCACGGCTGCTGATGAACTGTCGGAGCGGTGCGCCGCTGCCCCAGATGGTAAAGGGCTCACCACGCTGCTTGGCCAGGTAGCAC
TTGTGGATGAGTCCTGGGATAACGTGGCCGCCGTCGATGTTGAAGTTGTCGTGCGGTCCGTAGATGTTGGTTGGGATCACTGAAGTGAAGGCACAGCCGT
ACTGGTCGGCGTAGCAGCGGTTCATCGTGTCGATGAGTCGCTTGGCCATCGCATAGCCTTCGTTCGAGGCGTGCGGTCTCCCATCGTGCAGCATGCTCTC
GTCGATCGGGTACGTCGTCTTGTCAGGGAAGATGCAGGTCGACAGGCAGCTCACGACCTTCTCGACGCCGAACTCGTGCGAGCAGTGCAGCACCGCGTCG
TTCATGGCCATGTTGTCCCGGAAAAAGTCGACCTTGCGCGACAGGTTGTTGTAGAGTCCGCCCACGAGCGCCGCGAGGTGGATCACATGCGTCGGCCGGA
TGCGTTCGAAGAGCGCCTTGCACTGCTTGGCGTCGCGCAGGTCCGCGTCCTTGGAGCCGACAAAGTGCCACTCGTCCTCTGCCAGGTCCTGAGATCGCAC
CTCAGCCTGCAGCGCACATCCCACTAAGCCGGTGCCGCCCGTCACGAGCACCACGCGCGGCTTCTTCGCGACGCTTGATGGTCCCATATCTTCAATCTTC
AAAGTGACAAGATCGCAGCGTTTGAGTGGCGACCCAAAACAACGCTGTTCATTTGGGGAATCTGTCCATCTTTACAATTCGTCATAATGTAAAAATATCG
AATTGGGACAGTATCCATTTCGGAAGAAACATCCATGCAGCGTGCTCGCTACAGCTCGTCGACGCGGGTGCTCGGCTTGGCCGTATCCAGAGCGGCGGCG
ATGTCCACCTCGATCTCGAACGGTACCGTCGAGGTGCCGTATCGCTTGAACGGCTCGTGGTTGACCAGGAGGAACTTGGAGAAGTTCCACTTGATGTCGT
TCGTGACGAACCCAGTCAGCTTTTGCGTCAGGAACTTGAAGAGCGGGTGCGCGTGCTCGCCGTTCACATCGACCTGCAGCACGACACATACATCGTTAGG
AGCGTCGTGGTCATGTCATGATGACTAATTGGCTGGCCGTACCTTGGCAAAGATGGGGAAGGTGATGTGGTAGGTCGATTCGACGAACTGCTTGATGTCT
TGCGACGAGCCCGGCTCCTGCCGCCCAAACTGGTTGCACGGGAAGCCGAGCACCATG