Description :
From Genome Similarity Track
Location :
contig_32:446300- 447574
Transcript NameFunction/comments
g6246.t1conserved hypothetical protein

Sequence
1274 bases(100 bases per row)
TCGTCTTGCAACGCCCGTGACACTTCGGCCATCGCCACGCAGGACGAGAGCTTCGTCGCCCAGAAGGCGCGACCGGACATGGCAGCAGCAGGTCGAGAAG
ATTTGTCGCTCCGCTTCCCCTGCTTCACCAGCGCGTAGCAGTCGAGCGACATGAGGTGCGTCTGCAGCTCTTCACGGGATAATCGAGGCACCCAGGCGGT
CTGAGGGAGACCACGAAAGCGCGCCAGCTCCTCGCTGACTTGGTTCATATCGCACTGGTGCGATCGCTTGGTGCCGTCGTTTTCGTTGCTGCCGGGGCAA
GTGACGTGATCACGTACAGCAGCAGTTTCGCTTGTCTTGGTAGCTGCTTGATTTGCTGGACAACAGGGGACGAGAGCATTGCTGTAGCGCACTGAAACAC
GTCGCGCACCGTAACCTTCACAGGTGCGGCCGAACCCTCCAAAGCTGAACAGCTGACTGCGCCCGAGCGTTGAAGCGCGTGGCGGGCAGACTGCTGCAGC
AAACTGATGGCCAAGCGGGCGTCGCCATCTCGGGCTGCCACCTTCCTGGCAATGAGCTCAACAGCGCGAGGCTCAATGAACCTGGCCACCTCTGAGCTGT
CGGAACTTGACGCTCTCTGCACATAACTCTGCAGAATCAGCAGCAACTCCTGGTGCGAGTAGGAGCCAAAAACCACACGAGGGACCCTCGAGTCGTCAGA
GCCTTCACCGGTAACATGAACGCGGGACACCTGCTCGTACATGTCGACGCCGTTCATGATGCCCAAGAACTTGACCTCCGCAGGTGTCACATGGGCCCAC
CGCACCAAGAAATGGAGCAGCTCCTTCACCCTTGGCTGCATCCGCGCAGGAAGCCGCAGCAACTGGTCCACCTCGTCCAGCACCAGCACCACCGAGCGCT
GTTTCGCCTTCACACCGCGCTGCATTGCAACAAAGCTGTCGAGCGCGTACGGGTCCATCGCTTCAGGTACACTCCAGCTCGTAGTTTGACGCACCTGCTG
CGCCACGGCAGCGTACAGCGCCGCCGGATCCGTGAACGTGCTGCAGTTGAACCTGACCGCTGTCTTGGCGCCTTTCCTGGTTCGTTTCCGGTTCGTTGGC
GATGCAATTGCCACTGTCTCGTATCCCTGTTCTCTCAGCAGCTCATTCACCGAAGAGCTCTTGCCGGTACCGGGGGGTCCGATGATGAACAAACTGCCCT
GTGCGTCTCCCTTGAGCACTTGACGAACAACCTCGTGCTCTTGTGCACGGCCGACAATGGGCGAATCAGCGCGC