Description :
From Genome Similarity Track
Location :
Scaffold_283:44626- 46282
Sequence
1656 bases(100 bases per row)
CCCAAGTTGTATCTTCATAGCCAACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTTAGTGGTGTTCTGTCGTCGAGGATGGCCTC
GACTTCATATTCACCGGCAACTTGGTCTGGTTCCCAGCTGTCCTCAGGCAGTAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACC
AACCGAGTATTCGGTCGACTGTTGAACTCGTTGATAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCGCTTCGGCCAGGCAGTTCCA
TCCCGTACGCAAGCTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTTCGCCGAGTGTTCG
TTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCCGATAATCTTTGG
CCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGA
CCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTATTGCAAATACTAGCTTCTCCG
CGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGG
CCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAGAACCTCGCTCATGAAGCGTGGGCCGCGGTCGTGCCTTATTAAT
GATAGGGCTCCGAATCGTCGGTACACACATTCTTCCAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCTATGACGAATCCCGTGA
ACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAG
TACGTTGCCAGGTGAATATCCACGAAACTGTGGACGGCTTTTACTCGAGCTGCAATCTGGACAGGACTTCACGTGCTTCTCCACGTCTGCGTACAAGCCG
ATCCAATAATAATCGGACTTAACGCGGTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGAGAGTCGTGACAGTTTTGCAGGACCTCTTGAATCA
TCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGATAA
CACGAACCGGTCAGCATACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGT
TCCTCGTCTTGTACCACTAGTATCCGTCTGCGTCGCTCCCGCTGTATCGCTACCGG