Description :
From Genome Similarity Track
Location :
Scaffold_2:44617- 45937
Transcript NameFunction/comments
Physo_325758taurine dioxygenase, putative

Sequence
1320 bases(100 bases per row)
AAGTAGGGGACCTCACCGTGGGGGGTGACGCGAACGGCGTGGCGTTTGCCCGGCAAATAGTCGAAGGTAGCGTAGTGAGCAGTGACGCGGTTGTCCCAAA
TCGCCACAGCGTCCTTGGTCCAGTGGTAGCGGATCTGGAACTCGTGTCCTTGAGCGATGTGGTTGGTGAGGAAGCGCAGGACTGCATCTGTTGTATGTAA
GTGGAGTCAGAAAAGTATTCGTAAATTCCCAAGACACAACATTACATAACATCACTGCACCACCCCTCCCGACGAGTGAATACACGTCCGCAGCTTCACC
GTTTACGTACCTGACTCGGTGGTCGACAGGTTGTTAATGCGAGTCGTAAATTCGCTGTTCACGTAGAGCGCTTTCCGCTTTGTCACAGGGTGGGTGCGGA
CAACCGGGTGTTCGAATTCCACGATAGGGCGGTGGAGGGTTCGACCCTGCGCGATTGTAGCCTCGGCTTGAAGCTGTGTAATTCAAGTAACGGTGTGAGT
CTGTAAAATAGTGCAGCACGATACCTCACGATACCCCCGCACCTTGCTGCTATGGGTTGCTGTGAGTCCTTCAACAAACTTCTTGAATTGCGGCGTCAGA
CGTTCATACGCCTCGTAGGTTGAAGCCCAAACAGTGTCTCCGCCGGTAGGCGGTGGTCAAGACCTTGAAACTCGTGTAGGAAGGCGGCTACAAGCGGGAC
AACGGTTAATACAAGTATTAATTATAAGCAGGATTCCAGAACATACCTGGCGCTCGTACGACACATCACTGTGCCAAACCCACTGGTTGAAGTGTCTGTA
AAGGTTGCTCACAAGACGATCTTCACTCCCCTCAAGAGAGTTTTCAACGACGTGCACTTGGGGGATTCCCTTCGCGTGCGCCACCGTCTGATGCACGTGC
AGTGGGCCGTAGTAGCGTCCCAGCGCCTACTGCTCCTCAATGGAGATCTTCTGGTCGCGGAAGAACACCACGCCGCGCTGCGCCACCAGCAGCGCTAGCT
CGTCCTTCTGAGCGTCCGTCAGCTCGTGTAGCTGCAGGCCCGAGACCTCCGTGCCGATCTTCGGCTCCAGGTGCGTCACCGTTGCGTCGGCCAGCAGGTT
CTTGAACGTCGGGTCAGCCTTGAGCGCGCGGTCCTCGTACGGGAGCACGGGGATCGGGTCGTAGGTCTTGGTGGGGAACTCACCACGCAGCTCCGGGTGG
GTGAAAGGAGCGTGCTTGACCTCGAGGTTAAGAGCGTTCTTGATGGGGACAGGCGATGAGGCCCCCGCAGTGGTGGGGGCGGAGGCGGAGGTGGAGTCGT
TGTTCTTGGGAGCCATGGCG