Description :
From Genome Similarity Track
Location :
Scaffold_670:4460- 6048
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_670-snap-gene-0.3DNA replication licensing factor MCM8

Sequence
1588 bases(100 bases per row)
GACTGCTTCCGCGACCACGAGCAGTGGGGAGCGCTGCTGCTGAATGTATGTGGCTATGTGTATGACACTGGCTTGCTGTTAGCTGTAGTGTTAACACGCC
GTGCTTGTGCTTGCTAGTACGACCTGAGGGAGCCCGATGTCACGACCGTGTGGCTCAACTACACGGAGCTGATCCGCTCGGCGACCGGTCTGCCGGACTT
TGTGAGCGTGCTGCAGGAGAACATCGAGGACGTGATCCCATGCCTCGGTATCGCGCTCTGCATGCTGCGCCACGAGCTGCGGCAGGCGCAGGAGGAGACC
CCCGCGCGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTGCCGC
TGGACCGCACCAAGATAGCGGTGCGCCTGCACAGCGTCACGCCCGTGCTGCCTATCGCTGCACTCAAGGCCGACGTCGTGAACCAGTTCGTGAGCGTCAC
GGGCACGTGCGTGCGCGTGAGCGCGATCAAGCCGCTCGTGACGCGCTGCGACTTTGTGTGCGTCAAGTGCAACGACGTCACGTCGCGCGCGTTCCCAGAC
GGCAAGTACAACCCGCCCATGGCCTGTGAGAACTCGCCCTGTCGGAGCCGAACGCTGCTGCCGAATAGGTCGACGGTGGAGACGGTCGACTACCAGAAGA
TCAAGTACGTTTCGCTGGAACAGAGCTCGGGATATGCCATCGAGACACGCTAATCTATGTTACATGCCTACAGGATCCAAGAAATGGAGAACAACGACGC
TGGGCCAGGACGCATTCCTCGAATGGTACAGCACTCGCACCCTTATCGCCATGCTAGCAGAAGCTTTAACCTGTACCGCTGGTGTATTAACTATGTTAGG
TCGAGGTGGAGCTCTACGAAGACTTGGTGGACTCGTGCATCCCAGGCAATGTGGTGACGGTTACAGGCGTCGTGAAAAGCATCAACTCGGAGATCCACAG
CGGCCGGTACGGCAAGCGCGCGCAGACAAACAGCCTCTACATCCTCTACCTCTGCGCCAACTCGGTGCAGAGCTCGGCCCACGTGAGTCTCAAATGCTTG
GCATTCGCGTGATTAGGATATTAACGCATGGTGTTTGTATATGCTACGTGTTCTTCACAGGCTGATGAGAATGACAAAGATAAGACATCGGACATTGATT
TCACGAAGGAGGACCTGGAGCAGATCAGCAACATCATCAGCCAGGGCGACGTCTTCGACCGCCTCGTGCACTCGCTGTGTCCCGGGATCTATCGCAACGA
GATCGTGAAAGCCGGGCTCGTGCTCGCACTACTCGGAGGAACGCGGAATCCAGACGAGAAGGACTCAGCGTGCTTTTCGCGAGCCGACTCGCATGTGCTG
GTCGTCGGTGACCCGGGCTTGGGGAAGAGTCAGGTAAACGCCTACGCCCGGATCGCCAATTATCTGGCACTGACTCATTGTATATTTT