Description :
From Genome Similarity Track
Location :
Scaffold_222:446- 2071
Sequence
1625 bases(100 bases per row)
TCGACAATCATCTCGAATTCCAAAGGCGAGTAATCTTTGAACAGCGCCCCTCGGTGCTGATATGATTCTGCTTGAGTCAAGAGAACAACCTCCCCGTCCA
ATCGGAACATGCGGGCTCCGGTGTTTGTGCATCCCGCgacgccaccagcaacttgGTTTTCGCCATCGTCAGAGGCAATTATATCATTACGTTCGTTGTC
AACAGTCTGTTCATCGTAATCATCTTGTGTGGAACCCTCAGAACCGTCCGAAACAGCGCCATCAACACGTTGTGTGACCAAGTCCCCTTCATTAGACAag
cggccgaggagctcaaccAACGTATGTGGGAAGACGTACCAGAACGAATCACTGGATATGTAGCTACGGTATTCAGCCAATGCATACACCATTAACGAGT
GTGACCACTCGTTTCCTCCACTAAATGCATTCACCGTCCTGGTGGCTAAATGCTTAGCCTGGCGCATGTCGGACCCGCTGTCTTCAGCTACACTCGGATA
TTTGAGAATATCACTAATAGCAGTATGCATTACAACCGCCGCACATTTGAGGCCACCCTTTTCCTTCGTCATGTACGACTGCAGGTACTCCTCAACCATG
TCACCAGCGTCCTCACCATTCATAATTGCTGAGTTAGTATGCGAGGAGGTCAGACACGCAAGGGGTATATTTGTTTCCACAAACATTGCATCTTGCTCTG
GTCGTCGTTGCTCCCACACAATTGCACCGTCAGTACGCTCTCGCACTATCCTCTTGTTCGCGTTGTTCATCTTtccatcgacgacgtcggcaaTATCACC
GGATATTGGTTTAACAATAAATTGAGCATGTTGGCGTTTTCCCAGATGGCTCGCGCTTGTCAGTTTGATGAAAAGAGGCTGAGTAACATCGTTATGAACA
CCCGCCGGCCTTGATAAGCGGCACATACTTCGACCGCGGATGCCTTTCTGGCAGGTCGCTGAGTGACAGTGACTATTCGTTGATAGTGCCCTTCGTTCTG
CCGCCGTAAGAAAACCTTGAAAGTCCGTTGCAGCGTCCGGAACGGCGATTTCAAACGCCCGAGGCATTCTCCCGTGCGCCTCTTTCCATGCATTACACCA
TGCTCGTGTTCCAGCCGTTATTGTTGTACAAGAAACAGCGTCCATATACTGCCTCGCCTTCGGAACCAACTCGGGTGAACATGCGACCCGTGCTAGTAGA
CTAGGATTAACCGCCGAACCATACACGGTCATGTACGCGTGTAAACGCCCGTCCGCCTGCGGTTCAATTACCGCGTTGAATGCAGCACAACGGCCATACA
CACCACGTTCGGCCTCCAGATAATTAGTGCTTGAGCGAGTTCCACCGGAATCGCGGCACCGCATAATGTGATCTGTTAACGCTTTCACTTGCCTTTCGAA
AACTTGAGCAGATAGCGCCGGATACAGAGCCGATATCCTAAGGCGGGATCTAGCGTCACGTTGGATCAAATCGGGTAAGTCCGCAAACCGACACTCTTTT
TTTCCATACACACTACTAGCGTTATTCCACGCGCCGTGTTTTCGTAGGAGGGCGACACGATGTAGCAATAAGTCATCATGCTCTGGTGGTGCTAAGGTCA
CCCAATGTAGAGCAATACCATAACG