Description :
From Genome Similarity Track
Location :
Scaffold_455:446- 1773
Sequence
1327 bases(100 bases per row)
GGATGAGCTGATCTATTCCAAGCTGGAGAAGAGATATCTGCTTCCTCGTGGAGCCATCTCTCCGCGAGATTGCTTCGGGTCGCTCTTAGTGCTGATTTGA
tctcttggagtcctaactcaccttgttgacgtggggtaaaaattaaagccggattgaatttgtgcttggttgctgctgtacttgctgaacctttccagat
aaattgcttttgaagattttctagccgacgcaggacgtcctttgggtgtataaattgcttagccgtgtacagtattgatggtagtgccacgacattgaac
aatgctaccctttacGCCACCGAGTTGCTGATAGTAGTAGCAATTCTTAGTCGTCCTTGAATTTTTCAATTCGGATATCCCAGTTGTCACTGGCGGCCGA
TGTATTGCCGACCCAGTATCCAAGTTGTCTCGTTGTACTGGAGGGATGAAGGACAGGGAACCATTCCATTTTGTTGGTGTTCCGATAGTGTTGAGGCTAA
TCAAAATCCTTTTGTGAGGTTGAACCCGAAGTCCTGATACTCCACCAAAATCCCCCAGCAATCGTTTAACGAGGCTTAGTTCCTTCATGGAGCTCATAAA
TATCGTGCTATCGTCCACAAAGGCGGAAAACTTATGTCGTTCACTACCTCATCCTGAAATCGCAATTCCTTTTAGCTCCGGCTGACCGTTAATTGCTTGA
CCCAATGTATCGACCGCTAGAATGAATAAGAGAGGCGCCAACGGACACCCCTGTCTAATTCCTGATCTTACCACCCATGCGGTAGAAAGTTTGACATTGA
CTAGGAACTGCGCTGTAGTTCCTTCATGCAGAGTTCTGATTACTTTTAGGAAACTTTCAGAGAATCCATAGGCTCGGAGAACACTCTGTAAGAAGTTTCT
GTCAAGGGTGTCATACGCTTTTCTGAGGTCTAAACAGAGCACCGCAGCAGAATCAAACCATTCCATTCCTGAGTCTTCTTCGCTCATTTCCAAGATACTA
CGCAATATTGTCACTGTTTTTGTCTATACTGCCCCCGCACAAGCCCTGTTGAGATTTGCTGATTAACTTGGGGATTATCACACGGACCCGTTCAGCTAGA
ATACGGCCAAAGAGCTTGTACGCTGTATTTAACAATGCACTGGGTCGGTAGTCCATCGCGTCTGCTGAGTCTCCGTTTTTTTCTCAAGGGAATAACTGTT
GCAGTCAGAAAGGATCTTGGAACTCCATCACCTTTCATGATACTATTGAAGAGCTTAGTGAGTGTTGGTGTAAGCAGCTCCTCGAAATCCTTATAAAACT
CGTGGTTCAGACCTGTCGTCCCACCCG