Description :
From Genome Similarity Track
Location :
scaffold_17:445967- 448180
Sequence
2213 bases(100 bases per row)
CGGTAATTGCGGGTGTCGCAAGTCATTCATGAAAAATGGCGTTAATCCAGCAGGTAAATTAACATATTTGCTCATAGCAAACTCAACCAATGGTAACAAA
AAGCTTTATTTTTATGCACAGGAGCTTCTTAACACATCACCGACACTCGGTAAGCACGTTCTGTTTGCCAATCGGTACCGCTGTGAACATGTCCAAGCGA
GTGCCAAGTATTTGGAGCAATTATTCCCAAAAACCATTCGTGAATCGTGTATCACGACAAAGACGATGGCGCCTGGCAATCCGTAATTGCGAAAAATATG
GTCAATAACAATCTAGCCGAAACTTCGACATCGATGGAATTGCTACGCGGGAGCAATGCGAAACACCTTGCTGAATGTGTCAACAAAGTCGAGCACTGCA
TTGTGACCATCAGGATTCTCGGGGAAACCGAAGATCAAATCGAAACCGACTAATTTCCAACGGTCTAAAGGAAAAATGAGGCTCTGCAGTGGCACTTGCT
TGTGCCGTGCGCTCTATACACGCTGTCAGACATCGCATGTATTTACGTATAGTCCCACCCACTTGAACATATGATGCCACCAATTTTGGGCGCTAGGAGA
ctggtaggtcttctcacggccaAAGCGACCGGCCATCGGCGTATCATGACACAATCTTGTACTTTAAATTATTGTCGTGGGGAGCCACATTTCGTTTTCC
GTCGTCATGTGCCACTTTATAGTGAGGGAGAACCGTCTTTCATGCATAAAAATgcaattttgattttgaacgaCCAGGAAGCCTGTCATGGAATTTCATA
TCATTTGATCACGGTACtctgatgatcagatcacacTGTTTATCCTCAACATATgctcgacgtatcatatCGAATACATCGTTCGATATAGCCGATACGA
GCTAGCTGATAATCAGGACGAAGTGACGATGCGTCTTCCAGCAAGTTTATTTATCCTGGCTTGTACGCGACTGTGAAGTTGTATTATGCATAACGACAAC
CAGCGAGCCATCCGCTGTGACAAGTAAGGAGATTGAACTGCATATCGCAAGCTTGCGTCTTCAGTGTATACGACAAGAGCTGAACACGAGACCTCACCAG
AGCATTTACGAAAGCTCCTTATCGTTACAGGGTACTTCTTTGTTGCTGGCGTCATCTGTCGCGATTATAACGACACGATACGATCGAAACCTTCTGTGTC
CTTTTGCAAAACTGCACAACCGATTGCAGACTCAAAAGCCTCACACACGACGCTATGCGGCTTCGTATCAACTGTAAAGCAAGTAATGGTATTTTTATTA
AGCTGATCTTGATCTGACTGAGTTCTTCTTCACAAGTTGATGACCGCTTCTTTGGTTTCCTTCTTCAACAAGTTTGAAGGTGAGCGTACTGTTTCCACGT
AATTACGCGAGAAGCGATGCAGGTAATTGGACAGACCAATTTATTTTCTTAAATCCTTTTGATTCCGTAGCGTTTACAACGCCACGATATCTTTGATCTT
CTCACGGTCTGTAGGAACATCGTGTTCGACGACATAACATCCGAAGACCGGTACTTCCTTAGCACCGAAAATACACAATGAAAGTTCCCGCATGCAATCT
AGCACCACCCGAAGCTACTTCAAGTGCATTTCTTCCGCAGATCTGCCATCCGCGTCCCTAAAAATAAAACAAGAATATCGTCAACGTATGTTTGTGTGAA
GCTTCGCCTGGCCATACCAGTAAATCAATTGAACGTTGCTGTGGTATTGGATAGCCACTGTGACATTACATCCACTCTCATAACATACTGGACGGTGTAC
TAACGTAAAAGGtccctcatcaagatttggTAACATCCATCAACCAAATCAAGTGTACTAAACTGTGTTCAGCCGGGCGTAAAGTGAATGATGACATCCT
TACGCGGTATTGGCGTTTGAGCGGGAATAGTCTGCGCATTTAACTTGTTATAGGCGTGAACAATTCACCATTTACCTTTGGTTTGTGCACACAAACATCA
GCGCGCTTTGTGGAGACTTGCTGTTGCTCACCaaaccagcagcttgcttttaAGCAAAAAACCATCGATATACTAACTTTGCCCACGCCTCAGCGGCCTC
TGTTGAAGCACTGCATTTTTAAACCAGGTTCACGATCAATTTCGCGTCGAACTCCACGTTTGGGCGGAAGATCAGAGGGCGGCTCCGCACTAAGGACGTC
ATCCTTGTATCCA