Description :
From Genome Similarity Track
Location :
Scaffold_4:445948- 447504
Transcript NameFunction/comments
Physo_128240hypothetical protein

Sequence
1556 bases(100 bases per row)
GTGATTGAGAAGGGCAGCCCCGAGACCCCCGCCACGGCCAGCGAGACGGCACTTCAGGTCATTGCGAACACACCTCATGGCCGAGACGACCCGCCTCGTC
GTTCTCAAGGTTGCACCTACTGCCAACGGCCAAATCACGCCATCCGCGACTGCCGTGTGCTGCAGAAGCACCTGCGCACTGGTAATGTCAAGGAGGGCAC
AGTGCTGCCAGAGAACTTTGGCATTATCGACCGCAAGCCGAGGGATGCCCACAACCCCTTCCCGGCCAAGCAGCAGCGCACCCAACGCTCGGATGACCGG
CAGCGCCCACCCTCTCGCAATGAGAATGGGTTCAAGGGTCCGGACATCTATGATCGCTTTGGCAACCCGGTCAACTTCCAGGACCTCCAGCACAAGTTCA
GCTCGAGAGGACGCGAAGCGGGGCTCATCGCCTATGCGACTGTCATCATGCCGGACATCGGTCTGTCGGCTACGAGCTCTGACCCCCATGACCCTACGTG
GACAGTTGACTCAGGATGCACTCGCCATGCTGCTTACCAAGAGGCCTGGTTCAAGGAGATCCTCCTCTACGCCGGCGCCATCATGGTCGGTGGCAAGCAC
CAACTAGCCATCCGCGGCATTGGTGATGTGGTCCTCGAGGTGGTTGACACTACCGGTACTACCCGCCTCATGGAATTCCGTGATGTGCTATACGTGCCGG
ACATGAAGTTCAACCTCCTGGCCATTGCCCAGGAGCTGAAAATGGGTATTCGCCTTGTCTTCAGCAGCACTCGCTGCACCTTCTTCGTGGGCAAGGACTA
CAAGGTCCACGTCGAACTCGCGTCGGACATGAACCTGTTCCAGTTCAAGCCGAAAATCCCACTCAAGACACCCAGCGCGCTCGTGGCCCCAGCTCCTGCG
GACGATCAACCCGCCAATGCCCTTGTGGCTCAATCAGGTATGGACCCTGCTGTCTTATTGTGGCACAAGCGTCTCGGTCATCCTAACTTTCGTGTGATGC
AGACCATGTCTAGGACCCAAGCGGCCCCTGAACTGGCGTTCTCTCAAGCATCAGCGATCCCCAAACACTTCTGCCCCTCGTGCATCTTTGCTAAAGCACA
CCGTGCTCCATTCAAATGCAATGTTGATCGCTCTAAATTCCCTCTTGGAAAAGTTCATTCTGACATCAATGGCCCCTTGCCTTACCCAAGCCTAAGTGGC
GCTCACTACTTCATTACGTTCATTGATGACTACTCGCGCTTCATGCACCTATATGTCGTTGCGCGCAAGTCGGACTTGTACGATTGCTACGAGAAGTTCC
GTAAGGCAGCTAAAAACCGCTTCAACACTGAGGTCGGTACCCTGGAAACCCAATTCAATCAGTATGACCCTGAGGTGCAACGACTTCGGAGCGACAATGG
TAAGGAGTACGAAAAGCTCGGCCAGATCATATTTGATCGCTATGGCACGCATGCTCAGTTCACCAACGCGTATACACCTCAACAGAATGGCGTGGCTGAG
CGCCGGATGCGCACTATCCTAGAACCTCTGCGTGCCCTACTCATCGATGGTGATCT