Description :
From Genome Similarity Track
Location :
Scaffold_9:445872- 450957
Transcript NameFunction/comments
Physo_129837flagellar associated protein
Physo_155876translocation protein sec62, putative
Physo_129839predicted protein
Physo_129840cyclin C

Sequence
5085 bases(100 bases per row)
CCCCTCCAGCGCCGCGACGTCCGCGGAGGGCTCGGAGGCGACAGCGGGCGCAAGGTCCAGTGGAAACTGCAGCGTGGAGCCCGCCCCCGAGTACACGAAG
CGCGGGCGCACGATGCCGGAGACGCTCATCTGGTAAGCTTTGGGGGTCGAAGTTTGGCTCGGGAGTCTGACAGCCCCCAATTATTGTGATTTCGATTTCG
TTGAAGGGCGGAATCGGAAAGGCAATTAATTGGCGGTTGCGCTACGTTGGTGGTGTACCGTACCCAACACAAGCCACGTCACTAGTTGCCGATTGAGGGG
TTGTGATTGGGCCCCTACAAACAGACGGTTGCTGCTTACGGGGGCTGGAACAAGTCGCCCACTGTCTGCCTCATTATCGAACAGGCCACGCGTTGGATCG
AGCGTCAGCAGCAGCCAGATTGGAGCACGATGAGCGCCGAAGACACCCCCAAGACGGAAGCCGCATCCACGGTACGTCCATCTCGTCCGACCACGTGCTG
CCGTGGCCCGATTAGGCTCTAGCGCCCCGCTGGAGGCTCAAGATACGGCCCCGCAACCAACTACAGGAGAACACCGCAACTGACGCATTGCCCTCGTTGT
GCCCATTGCAGACGGCGGAAATGCCCTGGGAGACGGAGAAGGGCATCCGCAAGATGGCGGACCTGCTGCGCGGACGCAAGGGCATGCCCTCGCGCCACGC
CGTCGAACTCGGCAAGCGCGTCGAGTACTTCCGCGGCGACCGCCTCGCCACGTTCCTGCTGGCCAGCCCCATGGCGAAGAAGTACTTCCCGGAGATCAAG
ACCAAAGAGGACGTCCTCTCGGTCGGTCAGGCGCTGGTGCAGAACGAGTACATCCACCGCTCGGAGCGCGACGCCAAGAACAAGAAGCTGCTGAAGCCCA
CCCCCAAGCAGGACTTCTCCCCGGAGGGATACTACACGTGGATGTACGAGGGCTCCAAGACCCTCCGCAACATCATGACGGCGCTGCTGATCATCGGCTT
CCTCACCATTACGTGCTTCCCCATCTGGCCGCAGTGGGCCAAGGTCGCGCTGTGGTACATGTCCGTCACCTTCCTCATCTTCATCGCCATCTTCGTGGTG
GTGCGCCTCTTCATCTTCTTCATGCTCTGGATGATCGGTTACGAGTACTGGCTGCTGCCCAACATCTTCGACGACAACCTGTCGGTCGCCGACTCGTTCG
TGCCGCTCTACTCGCTGCGCTCCACGGACCCGTCGGAGCGTATTTACCGTATCGTTGGACTTGTTGCTTTCGCGTGCTTCTGCGTCTGGGTGAAGAACCA
GCCCACGGACTTCGACGAGTACATGAAATTGACCAAGCAGTTCACGGACGATATTTACAGTGGCAAGCTTCTGAGCGATATGTCGCAGAAGGACCAGGAC
AACATTGACGGCGTCAAGGTGCCCGACCTCGAGGATCTTCTTAAGGATGACGACGAGGATGACGACGACCAGGACGCCAAGTTCGCCAAGATCTTAGACG
AGGACGAGGAGGACAACTCGAAGTTTTCGGAGGCAACTGAGGACGATGAGGAAGTCGTAGACCGGGATTTGTAGACGGCAGCGAACAGGCAGACTAGCTG
ACTGACGGGCGCAAACACCGTAATTTCAACTTAGTACTTGATCATTTTGTTGTTGTGTGACGGCTCAATCTGCTGCATGGTGTTGCAGCTCCCTCCTACG
TGAATGAGAACATGTAGCAGCTTGTAAAGATATGAATACATGTAGTTTCGCCACGATAGCCACGCCATCGAGTGGCGCAGCGTGCACTTAGTTCCACGGA
GTGAGGGTGACCTCGTCGTAGACGACGCCGTTGCGATTCAGGATAAACTGCACGCTCATCGACTGTTCGGTCGATTCAATGCGCAAGTAGCCCCAGTCGC
TCAGGTGGCTCACGCTCCACTCGCCCAGTTTGCTCGAGAAGCCTGACTTCTCCAAACCAGCGCCTGCGGAGCCGATCACAATATGGACGGGTCCCTGGCC
GTCCTTAGTGCACTTGCCGTTGCGGACTGCACAACTGCGCTCGTAAGAGTGCTGGTGGCCTACGAGCATCAGGTTCACCTTGTGCTCCCACAGCAAGTCT
TCAACTTCCTCACGGAAATGCTGGGATACCTTGTAGTCGGCTTCTTCACCCAACTGCGTCGTGTACATCATCCGGTGCGATGTTAGCACGACCCACGGCG
TCTTCTTCCGGTCCACACTCTTCAAGTCGTTCTCCAACCACTTGTATTGCTTCGATCCACGGCGCCAGTCGTGCTCCGATGAAATCTGGATAACGTGGAC
ACCACCGTAGTCGAACGAATACCAATAGATACCGTTGCCATTAGCTGGGGCATCCCAGCGGTAGTACATCGGCACGGAGCATTCCCCGGATGAGTCCTCG
CCGTAGTTGGCCCACTCTGGGTGGAAGTCCATTCGGCCATCCTTTCCTGTAGCTCCACTGGGATCGTTGGCACCTCCCGTCGTGTAGTCATACTCGTGAT
TGCCGATGCTTACCATGTATGGGACTCTGGTCGCGTAGGGCTCGATGAGGTGGAAGAACTCGTCCCACATGTGCGCGTGGCCGCGGGCATAGCTGATGTC
TCCGAAGTGCAACAGGAAGCTGTCGTAGCCGTCCATCACGTCTTGGTACGAACGTACAGCCGTCGATGTCGCCGCAGGAGCAGGATCGACGCCCATATCG
GCGTACGCAATGAACTTGGCACTCTTCACCGAAGCATCTGGCCGACTCATAAAGGAGTGTACCGAGCTCCAACCGTCCTTCTCGCTGCCAAACCTGTAAT
AGTAGCGCGTTCCGGGCTTCAGTCCCTTCAAGATGACCGTGTGCATATTGCCTGGGTCTCGGAACCATTGCTGGCTCGTCAGATTCGCCGGTCGGTTACA
CAGGTGAGCTGCCGTGTACGTCTTGAACTTGCCCTCAGCTTGCTGATCCAAAGCATCGGGTTGGAGACCGTACTTGACCATGGGCGTCTCACGGGACGCC
GAATTGAACATCACCGACATCTCGTCGACATGTTCCGTCAAGGCAATGTGGCCGTGCTTGGGGGCAGTGAAGGCCTCCGCCATACCGACTTCCAGCTTGG
CAAGGGGGGCGAAGACGTTGCCTTTGGGCTGGAAGTTGAAGTACTCGACGGTGTAGTTGCAGCGCATCATGTAGAGCGCTGAGAAGCGGATGGAGTTGGG
CAGCGTGGGGCCGTCCGCACCAGGTCCATTGGCCTCCGTGATGCCAACCTTCACGAGGAAGTCCTTGTCATGGGCCTTCGGACCGCAGCTGAGACCCAGG
AAGTCCGTTTGATGCGGACGCTTGACGCCGCTCCAGGAGATCACCAGATCCTCGCCGTCCCTCAGCAGCGGCGGCGTTGCAGTCAGCACAGGGCCGCCCA
GATCCTCAGTCGCCTCGTCCTGGGCGAAGCCGTGCAGGAACCCAGCGGGGTCGTCCCGGGTGGCGTCCCAGACGCTGTCTTCGTAGTGGACGATGGGGCG
CGGGTCCCTCTCCAGCGCGTCGCGCAGCGTGTCTGCGTATCTGTAGCTCAGCGGGGGCTTGTCGGCCTGCACCAGCGCAGCCAGGAAAGCTGGAAGTAAC
AGCAAGGAGTGAAGAGGCGCGACCATTTCCAGCGCAATGGGGTTTCTTCCCCCGAGTCGCTTGTCTTCCACGCCGCCGATCCGGGAATGGCTCGCATGTT
GAACTGAGTTTCCTGTCCGTTTTGTGCCAAATGGCGAGTAGATAAATGCTCCGGTCCTGTCACTATCAAACGCATTTTCAATTGGTGTAAAATGCTGCAG
TTTCAACCAGTTAGCGCACTGGCGCGGTCAATACGCAATTTCCCATACTGGAGGCAGCACTTGCCACCATGGGCATGAACTTCTGGCACTCGACGCACTA
GTACGTGGGTCTACGCGCCCACGAGACACCAGAGAATGCGAAGCTGACGTCTGTGTGCACCACTTGACCAAAGTCTGTACTGGATGAAGGACGTGACCAA
GTCCGACCTGCGCAAGAGGAACCCGCTGGACCGCAAGCACCTGACGGACGACGAGATCGACAGCATCCACCTGGCCAACATTTCGCGTGAGTAGTCGCTA
AGGAAAAACATTCTAGACTAGATTAGAGGTTGTGAAGGTCACGGGTAGAGCAGAGTTGACCTCCCGGTGTTTGACGCAGTGCTGGAGGAGATTGGGCCGC
GCCTGCGGGTCCGCCAGATCATTATTTATACGGCAATCATCTTCTATCGGCGGTTCTACCAGACGTGGGCTGAGCACTTTGCTATTGGACGTGGAGGAAG
TTGTCATCTGACAAGTGGATTGTGTTGGTGCTGCAGGCAAAGCTTTGTGAACTTTGATCCACACTTGGTCGTCGGGACGGTGTTCTTCCTCGCCTCCAAG
GTGGAAGAGAGTCAACTGTCGCTCACGACCGTAGCCTCTGTTCTTCATCATTACACTACGAGTACGTTTTCGTCGTTTCTACCATCAGAATCAACGCAGA
AGGATACTCACTTGACATTGTGTTCGCTTGCGACTTGATTAGCTAGTGTCGATGAGGACGAGTCCATGTACACGTTCCAGGACAAGGATATCCTCGAGTG
CGAGTTCTACGTGATCGAGGCGCTGCAGTTTGATTTGATCCTGCACCACCCGTTCCCGTCGCTCCTCCAGTACGTAAGCCTCGTGTACTGGGAAATCTCT
CCTTTTTCCTGTTCTCACTCATGACGCTTTCTGGTCTGTAGGTTTCTGGATGAATTTGACATCCACGAGGAGTGTCTTCAGCTTGCATGGTAAGGCATGG
AGTGAATGCATCCCCACCTGGTTTAATGCGCTCTGCTGAGCTAATTCCGACGTGTTGTACGTGGTCCGACAGGCAACTCGTGCAATACTCGTACCGCACA
GACATCATTCTCTTGTACCCCCCGTTCATGGTAGCGTACGCGGCCGCGTACATCTCGTGCCGCGACGCAGGATATGATGCCGCGCAGGTGTTTGCCACCG
TGAACATCAAGAAGGACCTGCTACTGAAAATCGTTGGAGAGTTTCAGGAAGCAGTTGAAGACGAGAAAAGACTGTACGCGGTGCA